heat such as a hot pack or paraffin bath

... prmt1 morphants at gastrulation The shortened anterior–posterior axes in the prmt1 morphants at the segmentation stage indicate defects in convergence and extensions (C ⁄ E) at gastrulation At gastrulation, ... of myoD at paraxial ⁄ adaxial mesoderm at the 10-somite stage Dorsal views, anterior at top The lengths of myoD expressed paraxial ⁄ adaxial mesoderm are indicated In type 1, and morphants, the ... methyltransferase gene family in fish and ascidians Gene 340, 179–187 Scorilas A, Black MH, Talieri M & Diamandis EP (2000) Genomic organization, physical mapping, and expression analysis of the human...

Ngày tải lên: 28/03/2014, 23:20

... Raw EMG was amplified 5000 times The amplifier has a CMRR of 10,000:1 (Bortec EMG, Calgary AB, Canada) Raw EMG was band pass filtered (10 and 1000 Hz) and A/ D converted at 2000 Hz using a National ... overlap 98 points The bias was removed from the signal to allow resting activity to be at The peak muscle activity was found and each data point was divided by this peak muscle activity In this way, ... across trials was not used as this is not similar to what occurs during practice The control of proper form was limited to a visual assessment as this most resembles clinical practice Data collection...

Ngày tải lên: 13/08/2014, 14:20

... hyperglycemia and hyperinsulinemia Circulation 2000;101:2247-51 Takahashi K, Mizuarai S, Araki H, Mashiko S, Ishihara A, Kanatani A, Itadani H, Kotani H Adiposity elevates plasma MCP-1 levels leading ... Fujisawa H, Akimura T, Ishihara H, Kajiwara K, Kato S, Fujii M, Yamashita S, Maekawa T, Suzuki M Increased matrix metalloproteinase-9 in blood in association with activation of interleukin-6 after ... RESULTS The mean values for all OXANO measurements performed during and after clamping were numerically higher than the baseline measurements although no statistically significant change was observed...

Ngày tải lên: 26/10/2012, 10:03

... its patent portfolio as an important corporate asset and vigorously enforces its patents Products orfeatures contained herein may be covered by one or more U.S or foreign patents An Equal Opportunity ... industry has long targeted 99.999% (five nines) service availability, CATV has traditionally been more ‘relaxed’ in its commitment to always-on availability That attitude has changed MSOs have become ... plant By adjusting the output level at the node or amplifier, operators can control RF signal levels Signal attenuation and equalization is applied using plug-in attenuators and equalizers located...

Ngày tải lên: 17/01/2014, 11:20

Ngày tải lên: 18/02/2014, 07:20

... Tokuyama S, Moriya S, Taniguchi S, Yasui A, Miyazaki J, Orikasa S & Miyagi T (1997) Suppression of pulmonary metastasis in murine B16 melanoma cells by transfection of a sialidase cDNA Int J Cancer ... growth factor signaling A Fanzani et al the repair of damaged tissue In particular, myoblast proliferation is triggered by activation of the extracellular regulated kinase (ERK) pathway, whereas myoblast ... Claudio Basilico (Microbiology Department, New York University, USA) for the vectors harboring the constitutive activated form of AKT and its kinase-inactive form This work was partially supported...

Ngày tải lên: 19/02/2014, 06:20

... to the criteria was accurate because adequate dental documentation was present Furthermore, a homogeneous sample was needed to exclude factors such as race or gender This means that the results ... maxilla and mandible, a central and lateral incisor, a canine, a first and second premolar, and a first molar were measured from the left and right side alternately to exclude influences of facial ... Yousif N J 1996 A dynamic analysis of changes in the nasolabial fold using magnetic resonance imaging: implications for facial rejuvenation and facial animation surgery Plastic and Reconstructive...

Ngày tải lên: 19/02/2014, 17:20

... CTCCTCGTGCTTCCCCTCTACC GAGATCATCAAGCCCACCACAAC CGGGAAACTTAATGTCGAAGGAGAC ACATCTCGCCGTACTTCATCAACTC GGAGGAGGGCATCTTGGAACTC TGGATGAACCCACACCCAATC CGAGGCAACGGGCACTTC GAAGGCACTCAAGGACGCTAAAATG CTGAACCTTGGGAATACGAGTG ... CTGAACCTTGGGAATACGAGTG TCGATGGTACTGACCAAGATGAAGG GAGTCGTTGAAGTAGGCTGGAACTG TGCTGGATGTCACTCCTCTGTCTC TGGGTATGGTGGTGTTCCTCTTAATC GGACAAGGATGCCAAGAAGAAGAAG CAGTCGTTGGTCAGGGATTTGTAG Fragment length (bp) ... TGGTGATGCGAAGGGTCTTG GCCTCTCCTCGCCCTTTCAC TCCTCGGTAGCGCCACACTC GGTGCCCTTCTATGAGCCCTACTAC CCATCCTTTCCGATTTTCGACAC GTCACATCATGCGCCACTTTG TTGTAGCCATCGGGAACCTTGTAG GGCCACCACAATCAAATGTCAC CTCCTCGTGCTTCCCCTCTACC...

Ngày tải lên: 06/03/2014, 09:22

... of Arabidopsis thaliana Plant J 8, 505–520 Oka M, Miyamoto K, Okada K & Ueda J (1999) Auxin polar transport and flower formation in Arabidopsis thaliana transformed with indoleacetamide hydrolase ... of the auxin response factors (ARF) gene family in rice (Oryza sativa) Gene 394, 13–24 Jain M, Nijhawan A, Arora R, Agarwal P, Ray S, Sharma P, Kapoor S, Tyagi AK & Khurana JP (2007) F-box proteins ... Thakur JK, Tyagi AK & Khurana JP (2001) OsIAA1, an Aux ⁄ IAA cDNA from rice, and changes in its expression as influenced by auxin and light DNA Res 8, 193–203 Goda H, Sawa S, Asami T, Fujioka...

Ngày tải lên: 07/03/2014, 01:20

... Belorussian Bulgarian Catalan Chinese Croatian Czech Danish Dutch Estonian Finnish French Georgian German Greek Hebrew Hindi Hungarian Italian Icelandic Indonesian Japanese Kazakh Korean Latvian ... bisneta,bisneto,cˆ njuge,cunhada,cunhado,companheiro, o descendente,enteado,filha,filho,irm˜ ,irm˜ o,irm˜ os,irm˜ s, a a a a madrasta,madrinha,m˜ e,marido,mulher,namorada, a namorado,neta,neto,noivo,padrasto,pai,papai,parente, ... English as source language We applied our algorithm on a subset of 24 categories using each of the 45 languages as a target language Evaluation is done by two judges9 English as target language All...

Ngày tải lên: 08/03/2014, 21:20

... have been identified in a variety of plant species, such as pea, maize, tobacco and Brassica [9–12] Dnmt2 has been reported in yeast, Drosophila, animals and plants, suggesting an ancestral origin ... Kapoor M, Arora R, Lama T, Nijhawan A, Khurana JP, Tyagi AK & Kapoor S (2008) Genome-wide identification, organization and phylogenetic analysis of Dicer-like, Argonaute and RNA-dependent RNA ... cytosine DNA methyltransferases R Sharma et al known as DNA methyltransferases (MTases) These proteins in prokaryotes and eukaryotes possess a catalytic domain with conserved motifs that are arranged...

Ngày tải lên: 23/03/2014, 04:20

... temperature was confirmed via direct observations in the work of Kodambaka et al.8 These observations are important because the ability to grow uniform epitaxial Ge nanowires at low-growth temperatures ... epitaxial growth, numerous factors, such as substrate preparation, growth temperature, total pressure, partial pressure of the reactive gas, and metal catalyze size, need to be optimized.11–16 For ... P Manandhar, E .A Akhadov, C Tracy, and S.T Picraux: Integration of nanowire devices in out-of-plane geometry Nano Lett 10, 2126 (2010) 17 G.S Higashi, Y.J Chabal, G.W Trucks, and K Raghavachari:...

Ngày tải lên: 06/05/2014, 08:54

... Technical Editor Ashutosh Pande Editorial Manager Dipali Chittar Project Manager Patricia Weir Indexer Bhushan Pangaonkar Proofreader Chris Smith Layouts and Illustrations Shantanu Zagade Cover ... are assuming that you have installed the Dummy Package and have not created a template yet If you already have a template, you may skip the template creation section and go straight to the actual ... TYPO3 package you have installed—TypoScript can be learned with any package The following instructions are based on an installed dummy package Dummy Package You of course want to use TypoScript for...

Ngày tải lên: 01/06/2014, 09:27

... stored elastic energy Such a kinematic organization, governed by a cyclical unit, is qualified as harmonic (see [23] for details about harmonicity calculation) and Guiard [19] has argued this organization ... the task was to alternatively point at the targets as quickly and as accurately as possible during a 25 seconds trial As the error level cannot easily be controlled online during reciprocal pointings, ... deceleration Such a gaze-hand lead pattern is naturally assumed to allow (i) the early update of the initial hand motor plan on the basis of accurate target location encoding [13-15] and (ii)...

Ngày tải lên: 19/06/2014, 08:20

... silage have been made to date: Elephant grass with additives (molasses, salt & rice bran) Elephant grass and cassava leaf with additives Cassava leaf and green maize stover with additives Elephant ... phase of the project as well as the base data collection The visit also finalised arrangements for the purchase of AI equipment and semen from Vinh City; analysis of silage; evaluation of pasture ... establishment of a “best practice” 50 cow model farm on 19th May Co land The model farm to act as a nucleus for provision of breeding males as well as a coordinator and facilitator of “best practice”...

Ngày tải lên: 21/06/2014, 04:20

... Nghia Lam had good areas of rice land, large areas of sugar cane, water melons and most farmers had an area of Elephant Grass for feeding cattle Nghia Yen had good areas of rice and larger areas ... would be favourable for temperate forage crops such as oat/vetch mixes Table Annual climate data for Nghe An Rainfall (annual) Evaporation (annual) Temperature maximum (May) Temperature minimum ... used in silage or dried HAU has made pure cassava pulp silage with only salt as an additive • Soybean cake and Peanut cake Oil extraction factory near by The use of soybean and peanut cake left...

Ngày tải lên: 21/06/2014, 04:20

... sugar cane, water melons and most farmers had an area of Elephant Grass for feeding cattle Nghia Yen had good areas of rice and larger areas of land for cash crops (Sugar Cane, Cassawa, Rubber, ... feed shortages but may be favourable for temperate forage crops such as oat/vetch mixes or sub-tropical crops (sorghum/maize) Page 38 of 55 Table Annual climate data for Nghe An Rainfall (annual) ... demonstrations was to: • Provide a training platform • Evaluate alfalfa • Develop production, seasonal growth and management information on Ruzi grass and Guinea grass Detailed plot plans are shown...

Ngày tải lên: 21/06/2014, 04:20

... farmers have small scale silage tanks and choppers One large demonstration (2 tonne) silage tank has been built as well The best result for silage has been from cassava leaf/napier grass silage ... vice-chairman’s hat Mr Toan continues to a very good job as project coordinator and has put in a large amount of work on the purchase of the village bulls He also coordinated management contracts and ... project Vietnamese Institution 19 May Fruit & Vegetable Co; and Bavi Cattle and Forage Research Centre Vietnamese Project Team Leader Mr Nguyen Duc Diep Australian Organisation AusAID Australian Personnel...

Ngày tải lên: 21/06/2014, 04:20

... Total area cassave/village (ha) 205 N /A 250 108 205 305 2037 1555 3922 660 413 Total area sugar cane/village (ha) Total area oranges/village (ha) Total area other crop/village (ha) Total area Pasture/village ... best combinations of silage are: Napier grass 70% cassava leaf 30% green maize stove 60% cassava leaf and top 40% sugar cane top 70% cassava leaf and top 30% Napier grass with additives All four ... winter forage and financial return The project has found that farmers with land areas as small as 3,000 m2 can effectively support 5-6 cattle as long as they can access bi-product from other farmers...

Ngày tải lên: 21/06/2014, 04:20