... pitch, amplitude and pronuncia- tion and users are given immediate feedback on the acceptability of each recording. Users can then rerecord an unacceptable utterance. Recordings are automatically ... feedback on the quality of each utterance they record in terms of pronunciation accuracy, relative uniformity of pitch, and relative uniformity of amplitude. Confe- rence attendees will be able ... by a profes- sional speaker and manually polished, all other voices were created by untrained individuals, most of whom have ALS, in an untrained setting, with the recordings having no manual...
Ngày tải lên: 20/02/2014, 09:20
Ngày tải lên: 23/03/2014, 18:20
Giáo án Anh văn lớp 9 - Period 25: I.Aim: Writing a letter of inquiry :WRITE (page 37) potx
Ngày tải lên: 03/07/2014, 21:20
Example Questions for Writing Task II of IELTS
... introduce rapid urbanization. How far you agree? 38.When most of the population in developing countries do not have food to eat and place to live, it is immaterial to talk about saving forests as a ... as humans. We should stop all pharmaceutical companies from doing trials on innocent animals. Give your opinion in not to-face contact for its main means of communication? 34.Zoos are sometimes ... few changes in not less than 250 words. 7.Computers can easily do all the basic and advanced calculations. Do you think your children should spend more time learning basic mathematics or advanced...
Ngày tải lên: 04/10/2012, 10:24
Tài liệu Security Agreement and Pledge For Use with Letter of Credit pptx
... that his application is subject to final credit approval and that additional information may be required. By signing below the Applicant agrees that the Bank may place a hold on the Collateral ... XY-ZU-4715 Page 2 of 2 FOR CORPORATIONS ONLY: THE PRESIDENT OR CHAIRMAN OF THE BOARD OR ANY VICE PRESIDENT AND ONE OF THE FOLLOWING, SECRETARY, ASSISTANT SECRETARY, CHIEF FINANCIAL OFFICER OR ASSISTANT ... Franchise Tax Board, at any time, and disclose information given Bank to the Applicant. All owners / authorized signers must sign and include their titles. The Applicant understands and agrees...
Ngày tải lên: 20/12/2013, 17:15
A novel interval method for validating state enclosures of the
... parameters is 1 Further information about ValEncIA-IVP as well as free software are available at http://www.valencia-ivp.com. 6 of the error bounds R (κ+1) (t) . Note that neither separate ... optimal, and adaptive controllers. For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating enclosures of all reachable states. ... RESEARCH In this paper, VALENCIA-IVP has been introduced as a novel approach for validation of state enclosures for initial value problems with both uncertain initial conditions and tolerances...
Ngày tải lên: 12/01/2014, 22:04
Tài liệu A History of England for Boys and Girls pdf
... horror of war had filled the land for so many CHAPTER 19 47 was really to blame for it. So Aurelius Ambrosius and Uther Pendragon fled away to that part of France called Brittany, where they remained ... equal." Then Arthur was sad no longer. He did as Merlin advised, and had a great round table made, at which there was a seat for each one of his knights. After that there was no more quarreling ... last, weary of fighting, and forsaken by nearly all his followers, Alfred was forced to hide for a time in the marshes of Somerset. This was the saddest part of Alfred's life. He was a king,...
Ngày tải lên: 20/02/2014, 08:20
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... the data and in further projects of similar nature. For example, the ROUGE similarity could be used in the data collection phase as a tool of au- tomatic approval and rejection of workers’ assign- ments. 4 ... several passages of texts has for a long time been a research prob- lem within the field of automatic summarisation. For each document it is possible to create several summarisations that can each be ... minimum of $0.05) service fee per each paid reward. ã Qualications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” that are either system-provided or created...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu sixty years of reorganizing for combat a historical trend analysis potx
...
Ngày tải lên: 23/02/2014, 11:20
HEALTH PROJECT MANAGEMENT A MANUAL OF PROCEDURES FOR FORMULATING AND IMPLEMENTING HEALTH PROJECTS potx
...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... Engineering Research Council of Canada, the Alberta Heritage Foundation for Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada Research Chair in Bioorganic and Medicinal Chemistry. References 1. ... Edmonton, AB, Canada Type IIa bacteriocins, which are isolated from lactic acid bacteria that are useful for food preservation, are potent antimicrobial peptides with considerable potential as therapeutic ... University of Alberta) for performing all CD experiments. Albin Otter (Department of Chemistry) and Ryan T. McKay (NANUC, University of Alberta) are gratefully acknowledged for assistance with...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... PCR was performed on an egfp-containing plasmid (a gift from Dr K. Apt, Martek Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5Â-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3Â) and antisense ... (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5Â-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3Â and antisense primer 5Â-GAAT GCGGCCGCTCAGTCCTGCTC CTCGGCCAC-3 ¢, which introduced a NotI restriction ... PCR was performed using Pnr BamHI5.4kb as the template with sense primer 5Â-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3Â and antisense primer 5Â-TTCGAGCTCCGGGGAAACGGTGCCAACTT-3Â,which introduced a NotI...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... All grammar settings and annotations are saved and available the next time the user logs on. Finally on the Data Download page, users may download data so that they can use the patterns and ... Selection and Data Download. First a user has to specify, on the Grammar Selection page, which settings of the 13 parameters are of interest and save those settings as an available grammar. A user ... with all possible syntactic derivations of each pattern. The patterns and their derivations are generated from a large battery of grammars that incorporate many features from the domain of natural...
Ngày tải lên: 08/03/2014, 04:22
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt
... engaged in a strategy that places the company as major player in the regional mobile market place. With recent expansion into Nigeria, Rwanda, Swaziland, Cameroon and Uganda, the MTN brand ... See- Annex.6 table for reference to activities/initiatives of select UN organizations which are active in the area of ICTD. The path ahead: Many donor countries and agencies are actively examining ... 2001 2002 Chart 4: Bilateral Donors' Commitments for ICT Infrastructure Japan France Germany United Kingdom EC Canada Australia Austria Belgium Denmark Finland Greece Ireland Italy Luxembourg Netherlands New...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo khoa học: "A Figure of Merit for the Evaluation of Web-Corpus Randomness" ppt
... lan- guage, excluding function words, while Ueyama and Baroni (2005) built corpora of Japanese using seed words from a basic Japanese vocabulary list. Both Sharoff and Ueyama and Baroni evaluated the ... through a manual classification of the retrieved pages and by qualitative analysis of the words that are most typical of the Web corpora. We are also interested in evaluating the effect that different ... construct a “balanced” corpus via a search engine one reasonable strategy is to use appro- priately balanced query terms, e.g., using ran- dom terms extracted from an available balanced corpus (Sharoff,...
Ngày tải lên: 17/03/2014, 22:20
Held Fast For England A Tale of the Siege of Gibraltar (1779-83) pdf
... Siege of Gibraltar stands almost alone in the annals of warfare, alike in its duration and in the immense preparations made, by the united powers of France and Spain, for the capture of the fortress. ... in any danger of capture, save by hunger. At that period England was not, as she afterwards became, invincible by sea; and as we were engaged at the same time in war with France, Spain, Holland, ... midshipman, I was always glad enough to escape, when I had to dine with the captain." A week later, a young man came down from a city watchmaker's, with four handsome gold watches and chains...
Ngày tải lên: 17/03/2014, 23:20
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf
... This may be illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc. There are many words in our language about whose pronunciation ... the English language is the usage that prevails among the best-educated portion of the people to whom the language is vernacular; or, at least, the usage that will be most generally approved by ... PRONUNCIATION AS GIVEN BY THE BEST AUTHORITIES IN ENGLAND AND AMERICA BY OTIS ASHMORE SUPERINTENDENT OF SCHOOLS, SAVANNAH, GA. BOSTON, U.S .A. GINN & COMPANY, PUBLISHERS The Athenæum...
Ngày tải lên: 22/03/2014, 16:22
Đề tài " A C1-generic dichotomy for diffeomorphisms: Weak forms of hyperbolicity or infinitely many sinks or sources " ppt
Ngày tải lên: 28/03/2014, 22:20
A gene expression database for the molecular pharmacology of cancer pptx
Ngày tải lên: 30/03/2014, 13:20