... three lectins that are speci c for D -galactose Although the purified mulberry seed lectins were galactose -speci c, the crude protein extract of mulberry seeds did not bind to Sepharose 4B column ... Biol Chem 193, 265 –275 14 Andrews, A.T (1978) Electrophoresis Theory and Techniques and Biochemical and Clinical Applications, 2nd edn, pp 37 Oxford Science Publications, Metropolitan Police Forensic ... glass and the number of survivors in each vial were counted and noted From this data, the mean percentage of mortality of the nauplii was calculated for each concentration R E S U LT S Purification...
Ngày tải lên: 18/03/2014, 01:20
... … TTCGAGgtgagcaacccccca 309 2647 bp (exon 2, 177 bp) … CACCAGgtcagctgggcctca 423 418 bp (exon 3, 114 bp) … CCAAAGgcaagtgactttgca 401 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 371 bp (exon ... Backofen et al (Eur J Biochem 269) Confocal fluorescence microscopy Genomic organization of the NICN1 gene Confocal images of living cells were acquired days after transfection on a Leica TCS ... was carried out according to the manufacturer’s instruction For the human and murine NICN1 RT-PCR, a fragment of 194 bp was amplified using the primers NICN1_V362 (5¢-CAT CACCACTGTGGCTGTC-3¢) and...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo y học: " Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B" ppsx
... final concentration of 10 μg/ml and coupled to the surface of a research-grade CM5 chip (Biacore, Inc., Piscataway, NJ) by standard amine chemistry (NHS-EDC, Biacore, Inc.), to a level of 50-250 ... hybridoma clones were screened by SEB-specific ELISA (Recombinant SEB, highly purified, from Toxin Technology, Inc.) for specific SEB-reactive antibodies Clones highly reactive with SEB without crossreactivity ... production in both human PBMCs and mouse splenocytes in vitro [19] In this report, we detail the generation and selection of fully human monoclonal antibodies (HuMAbs) specific for Page of SEB...
Ngày tải lên: 11/08/2014, 08:21
GENERATION AND CHARACTERIZATION OF HUMAN MONOCLONAL ANTIBODIES WITH NEUTRALIZING ACTIVITY FOR DENGUE VIRUS
... repeated for higher enrichment of specific binders Antigen-specific phages are amplified by infection of Escherichia coli (E coli) To screen for the desired specificity, several in vitro assays including ... include vector control, development of a vaccine for DENV and specific therapeutics for DENV infections 1.2.5.1 Vector Control One of the most straightforward strategies for the prevention of ... dependent enhancement AF Alexa Fluor BHK-21 Baby hamster kidney 21 CD Cluster of differentiation cryoEM Cryo-electron microscopy DC Dendritic cell DC-SIGN Dendritic Cell-Specific Intercellular adhesion...
Ngày tải lên: 09/09/2015, 08:16
Báo cáo y học: "Characterization of monoclonal antibodies against Muscovy duck reovirus σB protein" ppsx
... selected to produce MAbs in mice and the ascitic fluids were used for further characterization The isotypes of MAbs were IgG2b (1E5 and 4E3) and IgM (2F7 and 5D8), respectively Concentrations of ... Authors' contributions YZ and HLC were responsible for the research design and writing of this manuscript ML, XDC, YW, YFL, and YFW, and NS performed monoclonal antibody preparation and characterization, ... which 50% binding occurred were obtained from the resulting dose-response curve Page of from mock-infected cells were added and incubated for h at 37 C For the reaction of MAbs, 50 μl of HRP-conjugated...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo hóa học: " Modeling and Characterization of VCOs with MOS Varactors for RF Transceivers" doc
... sections remains on varactors as the tuning element of LC VCOs The design, characterization, and modeling of the varactors significantly affect the overall performance of the LC VCO 3.1 Varactors ... tuning characteristics of LC VCOs, which further emphasizes the need for a good varactor model 3.2 VCO design and tuning characteristics For the following analysis, we used a standard LC VCO circuit ... buffer, interconnects, and device capacitances of M1–M4, the latter being somewhat voltage dependent Cav is the average capacitance of C1 and C2 in series (Figure 7(b)), calculated according to...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo vật lý: "Synthesis and Characterization of Bismuth Tantalate Binary Materials for Potential Application in Multilayer Ceramic Capacitors (MLCC)" doc
... range of 25oC to 200oC Z' (ohm.cm) Z'' (ohm.cm) (a) Z' (ohm.cm) (b) Figure 4: Cole-cole plots of BiTaO4 at temperature range of 550oC to 850oC Synthesis and Characterization of BiTaO4 58 The electric ... electrical homogeneity of the ceramic is confirmed by the presence of single, Debye-like peaks occurring at similar frequencies in spectroscopic plots of the imaginary components of the impedance ... number of space-charge carrier governs the spacecharge polarization As temperature increases, electrical conductivity increases due to the increase in thermally activated drift mobility of electric...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo khoa học: "Expression and characterization of the UL31 protein from duck enteritis virus" pot
... template for RT-PCR The PCR primers for UL31 cDNA and βactin cDNA are: UL31 f (5'-GTTGCTGCCCAG TATGTT-3') and UL31 r (5'-GTCGGATGCTGCTTGTAT-3'); β-actin f (5'-CCGGGCATCGCTGA CA-3') and β-actin r ... (5'-AAAGAATTCATGAGCCAGACCCAACCCCCG) as the forward primer and synthetic oligonucleotide UL31r (5'-TTAGTCGACTACGGCGGAGGAAACTCGTC) as the reverse primer BamH I and Hind III sites were incorporated ... Fund of the Key Scientific and Technical Innovation Project, Ministry of Education of China (706050), the Cultivation Fund of the Key Scientific and Technical Innovation Project, department of...
Ngày tải lên: 12/08/2014, 04:21
Synthesis and characterization of new metal carbon catalysts for hydrogenation of d glucose
... (a) RuC, (b) RuCu0. 3C, (c) RuCu0. 5C, (d) RuCu1. 0C, (e) RuCu1. 5C, and (f) CuC Figure 5.3 XRD patterns of catalysts: (a) RuC, (b) RuCu0. 3C, (c) RuCu0. 5C, (d) RuCu1. 0C, (e) RuCu1. 5C, (f) CuC Figure ... (a) RuC, (b) RuCu0. 3C, (c) RuCu0. 5C, (d) RuCu1. 0C, (e) RuCu1. 5C Figure 5.9 CO pulse titration peaks of catalysts: (a) RuC, (b) RuCu0. 3C, (c) RuCu0. 5C, (d) RuCu1. 0C, (e) RuCu1. 5C Figure 5.10 Catalytic ... elemental mapping of C (b), Ru (c) and Cu (d), respectively, correspond to (a) Figure 5.6 (a) Ru LIII-edge XANES spectra of RuC and RuCu0. 5C catalysts, (b) Cu K-edge XANES spectra of RuCuC catalysts...
Ngày tải lên: 11/09/2015, 10:18
Preparation and characterization of new magneto optical crystals for optical communication
... These coefficients are composed of electric and magnetic contributions Therefore: A=Ae+Am D=De+Dm C= Ce+Cm The theory predicts a temperature dependence of the magneto-optical properties which is controlled ... sublattices Mc can be written as follows: Mc =c n MYIG T 1.7.24 Where c is the Curie constant and n is a mean molecular field coefficient which is related to the classical coefficient by n=3ndc-2nac ... magnetooptical devices for optical signal Introduction –processing systems and optical communication systems (optical isolators and circulators, switches, time and spatial modulators, non-reciprocal...
Ngày tải lên: 16/09/2015, 17:12
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... Biochem 271) [28] Contrary to this, the speci c activity of pronase indicated that chitosan dissolved in aqueous acetic acid (1%) and was the best solvent when compared to formic and lactic acids ... in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation Formation...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... inhibition and hemagglutinatin study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid -speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii ... erythrocytes was marked by a 9-O-acetyl sialic acid -speci c lectin purified from the hemolymph of the snail Achatina fulica [64,66] Lectins are used for verification of the sugar speci city of the ... binding speci city of crab lectin Inhibition studies with various sugars was helpful in deducing the binding speci city of the lectin Fucose and lactose inhibited HA activity of purified lectin Sucrose,...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... used biochemical analysis, fluorescence confocal microscopy and electron microscopy to identify the HD-caveolae as speci c sites of fatty acid uptake and conversion to triacylglycerol, including ... electron microscopic identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking ... presence of additional specialized subgroups or classes of caveolin-containing membranes in the plasma membrane We now report the separation and biochemical characterization of three classes of caveolae,...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... under speci c conditions Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization ... DHP-GOU (Ca alcohol type) For EC and CY, reactions were initiated by addition of 0.1 mL of EC or CY to 1.0 mL of VM containing 10 lg of GOU For HP and M, reactions were initiated by addition of 0.1 ... lignin-related compounds, p-hydroxybenzoic acid, gallic acid and vanillic acid, as a sole source of carbon Cell growth and the production of the b-aryl ether cleavage enzyme We cultured 2BW-1...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNRYHRYH RYHRYHMNNMNNMNNMNNMNNMNNTGCTCCACACTTATACGTGCCACTG ... randomised loop CDR3 Library construction 6980 (‹) CDR3 Library construction 7210 (‹) (fi) (fi) (fi) (‹) (‹) (‹) 7211 (‹) GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC ... PCR using oligonucleotide primers N8517 (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC...
Ngày tải lên: 17/03/2014, 10:20
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified PCR product was ... primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG ... spectrophotometric activity assay Stereospecificity and substrate speci city The stereospecificity of T reesei TYR2 was studied by following the activities on 15 mm l-dopa, dl-dopa and d-dopa and...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... DNA and high micromolar concentrations of mitoDC-81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations of mitoDC-81 are easily achieved within the mitochondrial ... Pyrrol[1,4]benzodiazepine antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20, 1111–1119 ... antitumor antibiotics: relationship of DNA alkylation and sequence speci city to the biological activity of natural and synthetic compounds Chem Res Toxicol 1, 258–268 27 Petrusek, R.L., Anderson, G.L.,...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... Structural and functional approach toward a classification of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR ... involved Purification attempt of a soluble form of ccNiR Nitrite reductase activity was checked in the soluble cell fraction in order to investigate the existence of a soluble monomeric form of ccNiR,...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc
... CGGTGGCGACGACTCCTGGAGCCC-3¢; PR, 5¢-CG GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢; P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢; P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC ... 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢; P4-3, 5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA ATTCGTCGACGCGTTTTTCAACAAATCATCATAT A-3¢; TAG1, 5¢-GGAATTCTAGATATCGTCG-3¢; TAG2, 5¢-GGAATTCGTCGACGCG-3¢ Computer ... AAAATC-3¢; P2-4, 5¢-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC-3¢; P3-1, 5¢-ATGG GIAAYGARGTIGAYATHG-3¢; P3-2, 5¢-CTAGACC TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA ARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGG...
Ngày tải lên: 17/03/2014, 09:20