Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Eur J Biochem 270, 190–205 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03359.x Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) Kenichi Yamaguchi* and Alap R Subramanian Max-Planck-Institut fuer molekulare Genetik, Berlin-Dahlem, Germany and Department of Biochemistry, University of Arizona, Tucson, USA Six ribosomal proteins are specific to higher plant chloroplast ribosomes [Subramanian, A.R (1993) Trends Biochem Sci 18, 177–180] Three of them have been fully characterized [Yamaguchi, K., von Knoblauch, K & Subramanian, A R (2000) J Biol Chem 275, 28455–28465; Yamaguchi, K & Subramanian, A R (2000) J Biol Chem 275, 28466– 28482] The remaining three plastid-specific ribosomal proteins (PSRPs), all on the small subunit, have now been characterized (2D PAGE, HPLC, N-terminal/internal peptide sequencing, electrospray ionization MS, cloning/ sequencing of precursor cDNAs) PSRP-3 exists in two forms (a/b, N-terminus free and blocked by post-translational modification), whereas PSRP-2 and PSRP-4 appear, from MS data, to be unmodified PSRP-2 contains two RNA-binding domains which occur in mRNA processing/ stabilizing proteins (e.g U1A snRNP, poly(A)-binding proteins), suggesting a possible role for it in the recruiting of stored chloroplast mRNAs for active protein synthesis PSRP-3 is the higher plant orthologue of a hypothetical protein (ycf65 gene product), first reported in the chloroplast genome of a red alga The ycf65 gene is absent from the chloroplast genomes of higher plants Therefore, we suggest that Psrp-3/ycf65, encoding an evolutionarily conserved chloroplast ribosomal protein, represents an example of organelle-to-nucleus gene transfer in chloroplast evolution PSRP-4 shows strong homology with Thx, a small basic ribosomal protein of Thermus thermophilus 30S subunit (with a specific structural role in the subunit crystallographic structure), but its orthologues are absent from Escherichia coli and the photosynthetic bacterium Synechocystis We would therefore suggest that PSRP-4 is an example of gene capture (via horizontal gene transfer) during chloro-ribosome emergence Orthologues of all six PSRPs are identifiable in the complete genome sequence of Arabidopsis thaliana and in the higher plant expressed sequence tag database All six PSRPs are nucleus-encoded The cytosolic precursors of PSRP-2, PSRP-3, and PSRP-4 have average targeting peptides (62, 58, and 54 residues long), and the mature proteins are of 196, 121, and 47 residues length (molar masses, 21.7, 13.8 and 5.2 kDa), respectively Functions of the PSRPs as active participants in translational regulation, the key feature of chloroplast protein synthesis, are discussed and a model is proposed We have recently completed a comprehensive proteome analysis and protein identification of the chloroplast ribosome (chloro-ribosome) of a higher plant [1,2] The results showed that the chloro-ribosomal 30S subunit contains four chloroplast/plastid-specific ribosomal proteins (PSRPs) in addition to the orthologues of the full complement of Escherichia coli 30S subunit ribosomal proteins [1] The specific proteins were designated plastidspecific ribosomal proteins (gene designation, Psrp), PSRP-1 to PSRP-4 The chloro-ribosomal 50S subunit comprised the orthologues of 31 E coli 50S subunit ribosomal proteins (only two E coli ribosomal proteins were unrepresented, L25 and L30), and two additional PSRPs, namely, PSRP-5 and PSRP-6 [2] The intact Keywords: chloroplast-specific ribosomal protein; proteomics Correspondence to A R Subramanian, 5110 East Woodgate Ln., Tucson, AZ 85712, USA Fax: + 520 325 7957, Tel.: + 520 325 7957, E-mail: alapsubraman@aol.com Abbreviations: PSRP, chloroplast/plastid-specific ribosomal protein; pRRF, plastid ribosome recycling factor; RBD, RNA-binding domain in RNA-binding protein ( 80 amino-acid residues long); RNP1 and RNP2, conserved hexapeptide and octapeptide sequences in RBD; cpRNP, chloroplast RNA-binding protein; EST, expressed sequence tag; ycf, hypothetical chloroplast frame *Present address: Department of Cell Biology and Skaggs Institute for Chemical Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA, E-mail: yamaken@scripps.edu Note: The spinach peptide sequences reported in this paper have been deposited in SWISS-PROT under accession numbers, P82277 (PSRP-2), P82412 (PSRP-3) and P47910 (PSRP-4) The cDNA nucleotide sequences (spinach and Arabidopsis) have been submitted to the GenBank/EBI Data Bank with accession numbers AF240462 (PSRP-2), AF239218 (PSRP-3), AF236825 (PSRP-4), spinach, and AF236826 (Arabidopsis PSRP-4) (Received 29 July 2002, revised 30 October 2002, accepted November 2002) Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 191 chloro-ribosome (70S) revealed an additional protein in stoichiometric amount, the plastid ribosome recycling factor (pRRF), which is released on the dissociation of chloro-ribosome into subunits [2] Thus the chloro-ribosome proteome is composed of 59 distinct proteins: six PSRPs, a bacterial-type pRRF (in E coli pRRF is not a component of the ribosome), and 52 orthologues of eubacterial ribosomal proteins [2] These results thus confirmed the close kinship of the chloro-ribosome with the eubacterial ribosome [3–5] and also revealed a distinct departure, i.e recruitment of several large proteins during the chloro-ribosome evolution The results also re-confirmed the great dissimilarities among the three (cyto-, mito-, and chloro-) major types of ribosome [6] The rate of protein synthesis in chloroplasts increases dramatically on illumination, whereas the mRNA levels remain relatively unchanged through light/dark transitions (reviewed in [7,8]) Other significant differences between chloroplasts and bacteria in both gene expression and regulation of protein synthesis have been recognized Nuclear factors regulate chloroplast protein synthesis at several key post-transcriptional steps, e.g mRNA processing, mRNA editing, mRNA stability [9–15], and the translation initiation step plays a major role in the expression of several plastid genes, e.g light-induced translation of psbA mRNA is regulated by cis-elements including ribosome-binding sites and 5¢-UTR-binding proteins [16–18] Thus, while maintaining an overall resemblance to the eubacterial system, chloroplast transcription-translation has evolved numerous additional control elements to achieve its highly effective co-ordination between photosynthetic protein requirements and the ribosome function The PSRPs, located on the ribosome itself, are conceivably one set of control elements that have permitted the observed translational co-ordination Plastids (general name for the organelle, of which chloroplast is one of the differentiated forms) have their own genome, and employ for gene expression a transcription-translation system composed of both plastid-encoded and nucleus-encoded proteins Plastid ribosomes are responsible for the synthesis of fewer than a hundred polypeptides encoded in the plastid DNA, but these include some of the most abundant proteins in the biosphere, e.g the large subunit of ribulose-1,5-bisphosphate carboxylase/ oxygenase Moreover, certain key proteins of the photosystems have high rates of protein turnover required during their function (reviewed in [19]) Thus chloro-ribosomes have to maintain a high rate of protein synthesis, but, being dependent on photosynthetic chemical energy for function, have had to evolve mechanisms dealing with the diurnal and other variations in light intensity It would be interesting if PSRPs, either ribosome-bound or free, play a role in these global regulations of chloroplast protein synthesis Here, we report the protein isolation and characterization, and cloning of the cDNAs of three nuclear-encoded PSRPs; PSRP-2, PSRP-3a/b, and PSRP-4 Together with the previously reported results on PSRP-1, PSRP-5a/b/c and PSRP-6 [1,2,20–22], characterization of all six PSRPs in spinach (Spinacia oleracea) chloro-ribosome is now complete Homologues of all six PSRPs are identifiable in the complete genome sequence of Arabidopsis thaliana and in the expressed sequence tag database of other land plants We discuss light-dependent chloro-translational regulation, other possible functions, and evolution of the PSRPs Materials and methods Spinach chloroplast ribosome, 30S subunits, TP30 Spinach (S oleracea, cv Alwaro) chloroplast ribosomes were prepared as previously described [23] First, 5000 A260 units of ribosomes were run on a zonal sucrose gradient to obtain purified 70S ribosomes, and 3000 A260 units of purified 70S ribosomes were run on a dissociating zonal gradient to obtain 30S and 50S subunits (details in [21]) TP30 was prepared as described previously [1] Protein/peptide electrophoresis, electroblotting SDS/PAGE was performed by the method of Laemmli [24] 2D PAGE was performed as described previously [25] Tricine SDS/PAGE of peptides was performed by the method of Schagger & von Jagow [26] Molecular mass ă markers used were ovalbumin (43 kDa), carbonic anhydrase (29 kDa), b-lactoglobulin (18.4 kDa), lysozyme (14.3 kDa), bovine trypsin inhibitor (6.2 kDa) and insulin b-chain (3.4 kDa) Electroblotting was carried out as described previously [2] Protein/peptide purification with RP-HPLC Protein or peptide was resolved with a Vydac C4 column (4.6 · 150 or 250 mm) using the HPLC system described previously [1] The solvent systems and gradient conditions are described in the figure legends Internal peptide preparation from PSRP-2 and PSRP-3a/b After electrophoresis, 2D gels were stained for 30 in 0.1% Coomassie Brilliant Blue R-250 (CBB)/45% ethanol/ 10% acetic acid (w/v/v) and destained for 1–2 h in 25% ethanol/8% acetic acid (v/v) ÔIn-gelÕ digestion of PSRP-2 using endoproteinase Lys-C was carried out basically by the method of Hellman et al [27] with the slight modification described in our previous paper [2] For Asp-N digestion or CNBr cleavage, proteins from 2D gel spots corresponding to PSRP-2 and PSRP-3a were extracted as follows Five spots containing 10 lg protein/spot were placed in a 1.5-mL microtube and homogenized in 400 lL extraction buffer (1% SDS, 20 mM Tris/HCl, pH 8.0) using a small fitting pestle A further 400 lL of extraction buffer was added and the tube was shaken for 16 h at room temperature Peptide extract was separated from gel fragments by centrifugation (0.45 lm filter unit, ULTRAFREE-MC; Millipore), concentrated to 250 lL in a SpeedVac, precipitated with acetone (1 mL ice-cold acetone; 16 h at )20 °C), and collected as a pellet by centrifugation (20 000 g, 15 min) Endoproteinase Asp-N (Sigma) digestion was performed [ 50 lg protein in 80 lL 50 mM Tris/ HCl (pH 8.0)/2 M urea] for 16 h at 37 °C (enzyme/ substrate, : 100) The reaction was stopped by adding 20 lL 5% (v/v) trifluoroacetic acid, and the digest was subjected to HPLC CNBr cleavage was performed in 192 K Yamaguchi and A R Subramanian (Eur J Biochem 270) 100 lL 0.15 M CNBr/75% (v/v) trifluoroacetic acid (4 lg protein, 16 h, room temperature in the dark) After the reaction, CNBr and trifluoroacetic acid were evaporated under N2 gas and dried in a Speed-Vac The peptides obtained were kept at )20 °C until used Protein/peptide sequencing and MS Protein sequencing was carried out at the Laboratory for Protein Sequencing and Analyses, University of Arizona, using Applied Biosystem 477A Protein/Peptide sequencer interfaced with a 120A HPLC analyzer MS analysis was carried out at the Mass Spectrometry Facility, Department of Chemistry, University of Arizona, using a Finnigan LCQ electrospray ionization mass spectrometer (ESI MS) About 50 pmol protein in 10 lL 4% acetic acid was subjected to ESI MS Cloning and sequencing of PSRP-2, PSRP-3, PSRP-4 cDNAs A kgt11 spinach cDNA library prepared previously in our laboratory [28] was screened by thermal gradient PCR using a Mastercycler gradient PCR apparatus (Eppendorf Scientific, Inc.) PCR was performed (3 at 94 °C, 35 cycles of at 94 °C, at 43–60 °C for degenerate PCR or at 55 °C, 1.5 at 72 °C, and cycle of 10 at 72 °C) with 1.25 U Taq DNA polymerase (Gibco-BRL) in a 50-lL reaction volume containing lL kgt11 library ( 108 plaque-forming units), lM genespecific primer or lM degenerate primer, lM lambda arm primer (PF or PR), 200 lM each dNTP, 1.5 mM MgCl2, and 50 mM KCl in 20 mM Tris/HCl (pH 8.4) PF (forward primer) and PR (reverse primer) are complementary to the cloning site of kgt11 Degenerate oligonucleotide primers, P2-1, P3-1, and P4-1 were designed from the internal peptide of PSRP-2 (peptide 3, -MDIATTQA-, including CNBr-cleaved Met, see Fig 4A) and N-terminal sequence portions of PSRP-3 (-MGNEVDID-) and PSRP-4 (-PKNKNKG-), respectively Optimal annealing temperatures for the degenerate RCR were observed to be 57–60 °C for amplifications of 3¢-portions of Psrp-2 (P2-1/ PR) and Psrp-3 (P3-1/PR), and 50–57 °C for amplification of 3¢-portion of Psrp-4 (P4-1/PR) Here, for example, P21/PR stands for PCR amplified DNA using lambda library and primer sets P2-1 and PR Gene-specific PCR primers for Psrp-2, Psrp-3 and Psrp-4 (P2-2, P3-2 and P42) were designed from the nucleotide sequence of PCR products, P2-1/PR, P3-1/PR and P4-1/PR Tag-sequencecontaining primers complementary to 5¢-termini and 3¢-termini of PSRP-2 and PSRP-4 cDNAs (P2-3, P2-4, P4-3, and P4-4) were designed after sequencing the sets of PCR products The full cDNAs encoding PSRP-2 and PSRP-4 were amplified from the lambda library using the tagged primers The nucleotide sequences of Psrp-2 and Psrp-4 were obtained by sequencing P2-3/P2-4 and P4-3/P4-4 using sequencing primers, TAG1 and TAG2, and the two strands were completely sequenced by primer walking The phage clone of PSRP-3 cDNA was obtained by the following method The PCR product encoding 5¢-PSRP-3 cDNA portion (PF/P3-2) was labeled with 32P as described by the Ó FEBS 2003 supplier of Random Primed DNA Labeling Kit (Boehringer Mannheim) The lambda library (150 000 pfu) was plated on four 132-mm plates, and the plaques were lifted on to ICN BIOTRANS Nylon membrane Prehybridization was performed in 500 mM sodium phosphate, pH 7.0, at 50 °C for h and hybridization in 500 mM sodium phosphate (pH 7.0)/7% SDS at 50 °C for 16 h The membrane was washed twice in 100 mM sodium phosphate (pH 7.0)/1% SDS at 37 °C for 10 followed by a 10-min wash in 40 mM sodium phosphate (pH 7.0)/1% SDS at 37 °C and autoradiographed Plaques giving positive signals were purified and preserved by standard procedures [29] Insert DNA in the phage clone (PSRP-3-D1) was amplified by PCR using primer sets PF and PR, then cleaved by EcoRI digestion and subcloned into the plasmid vector pBluescript SK– (Stratagene) The insert DNA in Psrp-3 plasmid clone was sequenced Nucleotide sequencing was carried out at the DNA Sequencing Facility, University of Arizona, using an Applied Biosystems model 377 sequencer PCR products were analyzed by agarose gel electrophoresis using 1% (w/v) agarose gel and visualized by ethidium bromide staining Oligonucleotides used in this study were: PF, 5¢-CGGGATC CGGTGGCGACGACTCCTGGAGCCC-3¢; PR, 5¢-CG GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢; P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢; P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC AAAATC-3¢; P2-4, 5¢-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC-3¢; P3-1, 5¢-ATGG GIAAYGARGTIGAYATHG-3¢; P3-2, 5¢-CTAGACC TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA ARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢; P4-3, 5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA ATTCGTCGACGCGTTTTTCAACAAATCATCATAT A-3¢; TAG1, 5¢-GGAATTCTAGATATCGTCG-3¢; TAG2, 5¢-GGAATTCGTCGACGCG-3¢ Computer analysis A homology search was performed using the BLAST program ORFs from cDNA sequences were analyzed using the ÔmapÕ program from the GCG software package [30] Sequence alignments and comparisons were performed using PILEUP and GAP programs in the same package or CLUSTAL W [31] The results were displayed using BOXSHADE (version 3.21 written by K Hofmann and M D Baron) or manually modified Secondary structure prediction was by the methods of Chou & Fasman [32] and Garnier et al [33] using GCG software Protein and gene nomenclature The protein and gene nomenclature in this paper are in accordance with the Commission on Plant Gene Nomenclature rules [34], and follows our previous paper [1,2] E coli orthologues of ribosomal proteins S1–S21 were designated PRP S1 to PRP S21 (P, for plastid; C was not used for chloroplast to avoid confusion with C, cytosolic) The six PSRPs are designated PSRP-1 to PSRP-6, and their genes, Psrp-1 to Psrp-6 (see Table and our previous papers [1,2]) Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 193 Table Characteristics of chloroplast-specific ribosomal proteins (spinach) Protein name Subunit location Chain length PSRP-1 30S 236 PSRP-2 PSRP-3 30S 30S 198 121 PSRP-4 30S 47 PSRP-5 50S PSRP-6 50S 80 (a) 58 (b) 54 (c) 69 a Molecular mass Isoelectric pointa 6.2 26 805b Ref.c [21] New New 21 > 13 13 665b 794a (a) 794a (b) 174b 5.0 < 4.9 (a) 4.9 (b) 11.8 7 255b (a) 066b (b) 638b (c) 387a 11.5 (a) 12.2 (b) 12.2 (c) 10.6 Calculated from mature protein sequence precursor sequence b Other name and ref New [2] [2] CS-S5 [20] S22 [92] S30 [21] Similar protein and ref Synechococcus lrtA lightrepressed transcript A product [86] S31 [36] SCS23 [93] L40 [94] PsCL18 [22] Chloroplast ribonucleoproteins [44,45] P purpurea ycf65 hypothetical chloroplast reading frame product [48] T thermophilus 30S ribosomal protein Thx [52] PsCL25 [22] Obtained from mass spectrometry c For cloning and sequencing of cDNA encoding full Results and discussion Identification, isolation, N-terminal/internal peptide sequencing and MS of PSRP-2, PSRP-3 and PSRP-4 Spinach chloroplast ribosome was first purified on a zonal sucrose gradient, and the ribosomal 70S peak collected was then run on a dissociating zonal gradient to obtain pure 30S and 50S subunits free of adhering stromal proteins (see [21] for details and gradient profiles) As described [21], efficient dissociation of chloroplast ribosome required a phosphatecontaining buffer The total protein from the 30S subunit (TP30, 200 pmol) was subjected to 2D PAGE (Fig 1), and the resolved proteins were electroblotted on to poly(vinylidene difluoride) membrane for N-terminal sequence analysis All of the 30S protein spots were excised from the blot and subjected to N-terminal protein sequencing analysis We identified in the chloroplast 30S subunit the orthologues of all E coli 30S ribosomal proteins (S1–S21) and the details are reported in a previous paper [1] We designated the four additional proteins present in the chloroplast 30S subunit PSRP-1, PSRP-2, PSRP-3 and PSRP-4 (see Fig 1) PSRP-1 has been previously characterized [20,21], and its cDNA cloned and expressed in E coli [35] PSRP-4 has also been previously identified but only partially sequenced and had been designated S31 [36] We therefore proceeded with the characterization of PSRP-2, PSRP-3, and PSRP-4 The N-terminal sequence and the yield/recovery of phenylthiohydantoin (PTH)-amino acids from Edman degradation were: PSRP-2, NH2-VVTEETSSSSTASSSS DGEGA- (21 amino acids, 41 pmol per spot); PSRP-3, NH2-VAPETISDVAIMGNEVDIDDDLLVNKEKLK VLVKPMDKXXLVL- (43 amino acids, pmol per spot); PSRP-4, NH2-GRGDRKTAKGKRFNHSFGNARPKN KNKGRGPPKAPIFPKGDPS- (43 amino acids, 37 pmol per spot) The yield of 37–41 pmol PTH-amino acids per spot for PSRP-2 and PSRP-4 corresponded to that for the other 30S ribosomal proteins (average, over 30 pmol) The results supported the view that PSRP-2 and PSRP-4 are unit proteins on the chloroplast 30S subunit With respect to Fig Two-dimensional gel pattern of spinach chloroplast 30S subunit proteins: resolving PSRP-2, PSRP-3a/b, and PSRP-4 TP30 (200 pmol) electropherogram stained with Coomassie Blue (as landmarks, S1a/b, S4, S6a-e and S10a/b are shown) First dimension: pH 5.0 in 4% (w/v) acrylamide gel containing M urea; second dimension: pH 6.7 in 10% (w/v) acrylamide gel containing 0.2% SDS Inset shows a poly(vinylidene difluoride) blot of the acidic proteins, stained with Amido Black For better resolution, the gel was run twice as long in the first dimension PSRP-3 spots a and b (circled) indicate the N-terminal blocked and unblocked forms, respectively Note: small acidic proteins are stained weakly by Amido Black Molecular sizes and isoelectric points (pI) shown are based on the characterization in our two previous papers [1,2] PSRP-3, the yield of PTH-amino acids was significantly lower (7 pmol per spot); however, the Coomassie Blue staining intensity of its spot was similar to that of the other spots in that region of the gel Therefore, a partially blocked N-terminus for PSRP-3 was indicated To confirm whether PSRP-3 is N-terminally blocked, electrophoretic separation of the two forms (blocked and unblocked) was attempted by running the first dimension gel of the 2D PAGE for twice as long The PSRP-3 spot was resolved into two spots, a slower migrating spot marked a, and a faster migrating spot marked b (Fig inset) The two 194 K Yamaguchi and A R Subramanian (Eur J Biochem 270) spots were excised and subjected to N-terminal analysis Edman degradation gave a clear N-terminal sequence for the weaker staining b spot (9 pmol per spot), but an unclear sequence for the stronger staining a spot (insignificant yield, less than pmol per spot) From its slower electrophoretic migration in the first dimension gel, the a form is expected to be more acidic than the b form (i.e loss of a positive charge/net gain of a negative charge, making the protein more acidic) To confirm that the more acidic a form is N-blocked PSRP-3, a spots were excised from several gels, and the extracted protein was cleaved with CNBr The CNBr fragments were separated by Tricine SDS/PAGE/electroblotting, and two of the CNBr fragments (Peptide and Peptide 2, Fig 2D) were sequenced: Peptide 1, GNEVDI-; Peptide 2, EKNIGLALDQTIPG- Peptide has the same sequence as part of the N-terminal sequence of PSRP-3 (Gly13–Ile18) above Peptide is a new sequence, and it was considered to be an internal peptide sequence from PSRP-3 (subsequently confirmed by DNA sequencing of PSRP-3 clone) The experiments thus demonstrated that PSRP-3 exists in two forms (designated a and b), the alpha form being N-blocked and the b form having a free N-terminus The approximate ratio of the two forms is : For cloning PSRP-2 (by PCR screening a spinach cDNA library using degenerate oligonucleotide primers), the predominantly serine/threonine-rich N-terminal sequence obtained above was unsuitable Therefore, internal peptides of PSRP-2 were prepared HPLC resolution of the peptides from two protease digests (endoproteinase Lys-C and endoproteinase Asp-N) are shown in Fig 2A,B Long peptides containing aromatic (high UV absorption) and/or acidic amino acids are eluted late in RP-HPLC; these amino acids (W, Y, F, D, E) have less than average degeneracy Therefore, four of the late-eluted tall peaks were taken for sequence analysis In addition, PSRP-2 spots were excised from several 2D gels and the extracted protein was subjected to CNBr cleavage (CNBr generates long fragments generally; also the cleavage occurs at the carboxyl of Met which has zero degeneracy) Peptide fragments were separated by Tricine SDS/PAGE (Fig 2C), and two were taken for sequencing The five internal sequences obtained were: Peptide 1, YDKYSGRSR RFGFVTM-; Peptide 2, VNITEKPLEGM-; Peptide 3, DIATTQAEDSQFVESPYKVY-; Peptide 3a, DSQFV(contained in Peptide sequence); and Peptide 4, DFFSEKGKVLGAKVQRTPG- Being a very basic protein, PSRP-4 could be readily purified by RP-HPLC of mg TP30 on a Vydac C18 column (Fig 3A); the purified protein showed a single band, corresponding to the fastest migrating band of TP30 on the 1D gel, and a single spot on the 2D gel (Fig 3A, insets) The purified PSRP-4 was subjected to ESI MS The spectrum (Fig 3B) showed multicharged (+ to + 11) ions in the 400–1400 m/z (mass to charge ratio) region The deconvoluted mass spectrum (Fig 3C) showed a single peak with a molecular mass of 5174 Da This observed mass and the sequence mass calculated from the PSRP-4 aminoacid sequence (see next section, Fig 4C) are in excellent agreement Thus, PSRP-4 is not post-translationally modified to any significant degree Ó FEBS 2003 Fig Isolation of internal peptides from PSRP-2 and PSRP-3 (A) HPLC separation of endoproteinase Lys-C Ôin-gelÕ digest of PSRP-2 (10 lg, extracted from 2D gel spots) Peptide and the N-terminal peptide were sequenced CBB, peak of Coomassie Blue (B) HPLC separation of endoproteinase Asp-N digest of PSRP-2 (40 lg, extracted from 2D gel spots) Peptides 3a and were sequenced RPHPLC was carried out on a Vydac C4 column (150 · 4.6 mm) using a step linear gradient of acetonitrile (MeCN) in 0.1% (v/v) trifluoroacetic acid (0% MeCN up to min, 40% MeCN at 65 min, 80% MeCN at 75 min), at a constant flow rate of 0.5 mLỈmin)1 (C) Poly(vinylidene difluoride) blot of CNBr-cleaved fragments of PSRP-2 (4 lg, CNBr fr.) and intact PSRP-2 (2 lg) Peptides and were sequenced (D) Poly(vinylidene difluoride) blot of CNBr-cleaved fragments of PSRP-3a (4 lg) and intact PSRP-3a (2 lg) Peptides and were sequenced CNBr fragments were separated by Tricine SDS/PAGE and electroblotted on to a poly(vinylidene difluoride) membrane, and stained with Amido Black Peptide peaks/bands indicated were analyzed in an automated protein sequencer Isolation of PSRP-2 and PSRP-3 directly from TP30 on an HPLC C18 column was not effective, because they were coeluted with a few other proteins [1] However, LC/MS analysis of an HPLC fraction (pool 18 in [1]), which contained PSRP-2, PRP S4 and PRP S8 resolved the molecular masses, and yielded an observed mass of Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 195 cDNA cloning and nucleotide sequencing of the cytoplasmic mRNAs for PSRP-2, PSRP-3 and PSRP-4 Fig Purification and MS of PSRP-4 (A) RP-HPLC profile of TP30 (1 mg) resolved on a Vydac C18 column (250 · 4.6 mm) using a step linear gradient of isopropanol (IPA) in 0.1% (v/v) trifluoroacetic acid (10% IPA from to 10 min, 25% IPA at 80 min, 45% IPA at 250 min) at a constant flow rate of 0.5 mLỈmin)1 Every peak in the 0–100 retention time was subjected to SDS/PAGE, MS, and protein sequencing (asterisk, nonprotein peak) S17frg is a truncated form of S17, see [1] Inset (1D and 2D) shows that the smallest protein band of TP30, a 7.5-kDa protein, corresponds to PSRP-4 in 2D PAGE (B) ESI MS of PSRP-4 Each peak represents an individual charged ion The m/z ratio and the number of positive charges on the ion are shown above each peak (C) Deconvoluted mass spectrum of the m/z series in (B) indicates a single protein of molecular mass 5174.30 Da 21 665 Da for PSRP-2 This value exactly corresponds to the sequence-calculated mass of PSRP-2 (see next section, Fig 4A), suggesting almost no post-translational modification in the mature protein PSRP-3 could not be observed using ESI-LC/MS or MALDI-TOF MS This may be due to the poor ionization of this protein A few other ribosomal proteins, e.g PRP L2, could also not be observed in our ESI MS and MALDITOF MS experiments [2] Thus, we can offer no suggestions on the nature of the N-terminal blocking in PSRP-3a or on the possibility of additional post-translational modifications in either form PSRP-2, PSRP-3, and PSRP-4 were considered to be nuclear-encoded proteins because the N-terminal sequences and internal sequences, reported above, are not encoded in the plastid genome sequence of spinach [37] or other higher plants [38] Therefore, inosine-containing degenerate primers were designed from the peptide sequence information, and used to screen a previously described kgt11 cDNA library [28] First, partial cDNA was specifically amplified using sets of degenerate primer/lambda arm primer, and further PCR amplifications were carried out using sets of gene-specific primer (based on the cDNA sequence obtained) and lambda arm primer (PF or PR) The cDNA clones were finally obtained by a third PCR amplification using tagged primers complementary to the 5¢ and 3¢ ends of cDNA inserts (see Materials and methods for further information), and both strands of the cDNAs obtained were completely sequenced The nucleotide sequences of the cDNAs encoding the precursors of PSRP-2, PSRP-3, and PSRP-4 are shown in Fig The PSRP-2 precursor cDNA comprises 1242 bp [excluding poly(A) tail], the ORF (nucleotides138–920) encoding a putative 220-residue protein The N-terminal sequence of mature PSRP-2 begins at residue 63, suggesting a 62-residue transit peptide, and a 198-residue mature protein of sequence mass 21 665.02 Da and theoretical pI 4.99 The nucleotide sequence of PSRP-3 precursor cDNA comprises 751 bp, with an ORF (nucleotides 41–580) encoding a putative 179-residue protein The mature PSRP-3 begins at residue 59, suggesting a 58-residue transit peptide and a 121residue mature protein of sequence mass 13 794.02 Da and theoretical pI 4.93 [The molecular mass of PSRP-3, estimated from Tricine SDS/PAGE (Fig 3D) or SDS/ PAGE [2], is 14.0 kDa, close to the sequence mass, indicating no heavy post-translational modifications.] The nucleotide sequence of PSRP-4 precursor cDNA comprises 521 bp, with an ORF (nucleotides 22–327) encoding a putative 101-residue protein The mature PSRP-4 begins at residue 55, indicating a 54-residue transit peptide and a 47residue mature protein of sequence mass, 5173.80 Da and theoretical pI 11.80 The 87, 57, and 43 amino acids of PSRP-2, PSRP-3, and PSRP-4 sequences, determined from protein work (underlined in Fig 4, corresponds to 44%, 47%, and 91%, respectively, of the mature protein chain lengths), showed 100% match to the cDNA-derived sequences As noted above, the MS molar masses of mature PSRP-2 and PSRP-4 suggest an absence of post-translational modifications Sequence homology of PSRP-2 to ribonucleoproteins containing two U1A-type RNA-binding domains A homology search using the BLASTP program revealed a significant sequence similarity of PSRP-2 to a large number of proteins that carry one or more conserved RNA-binding domains These domains (called RBD, but also RRM for RNA recognition motif) are well characterized in human U1A small nuclear ribonucleoprotein (U1A snRNP) An RBD is defined as having an  80residue sequence, containing a conserved octapeptide 196 K Yamaguchi and A R Subramanian (Eur J Biochem 270) Ó FEBS 2003 (RNP1) and a hexapeptide (RNP2) separated by about 30 amino acids [39] The RBD folds into a compact structure of four antiparallel b-sheets and two a-helices (b1-a1-b2b3-a2-b4) with the conserved RNP1 and RNP2 located in the b1 and b3 antiparallel strands [39] Both RNP1 and RNP2 are important elements for recognizing the target RNA The highest alignment score of PSRP-2 was actually to a small group of RNA-binding proteins (cpRNPs) present in the chloroplast stroma Other high-alignment hits were: polyadenylate-binding proteins, glycine-rich RNA-binding proteins, heterogeneous nuclear ribonucleoproteins (hnRNPs), and small nuclear ribonucleoprotein (snRNP) [40–43] The three tobacco cpRNPs, cp29A, cp31, and cp33 [44,45], are shown aligned with the PSRP-2 sequence in Fig 5A, with sequence identities (similarities) of 36.5% (48.7%), 36.2% (48.9%), and 39.1% (48.7%), respectively The primary structure of PSRP-2 appears to be related to that of the cpRNPs, with a similar arrangement of the two RBDs, but with a shorter, less negatively charged N-terminal domain and a truncated (by 8–30 residues) C-terminal domain (Fig 5A) A comparison of PSRP-2 with several other RBD-containing proteins (spinach 28 RNP, Chlamydomonas reinhardtii RB47 poly(A)-binding protein, barley cold-inducible glycine-rich RNA-binding protein, Anabaena variabilis RNA-binding protein, human hnRNP, and human U1A snRNP) shows high conservation of the RNP1 and RNP2 sequences between these proteins and PSRP-2 (Fig 5B) Convergent evolution has been suggested for the sequence relationship between bacterial RNA-binding proteins and eukaryotic glycine-rich proteins, and a phylogenetic analysis has indicated that cpRNPs are likely to have diverged from eukaryotic glycine-rich proteins, rather than from cyanobacteria [46] As it appears structurally closely related to cpRNPs, PSRP-2 may also have a eukaryotic, evolutionary origin The RBD-containing proteins are generally associated with RNA processing: splicing, localization, and stabilizing In the U1A protein, the aromatic residues of RNP1 and RNP2 are critical for RNA-base stacking [39] Because such aromatic residues in the putative RBDs of PSRP-2 are conserved (Fig 5A,C), PSRP-2 probably performs a similar RNA-binding activity As protein synthesis in chloroplasts is remarkable for its mRNA storage in the dark and light-induced translational spurt, we would like to suggest a role for PSRP-2 in this process However, as PSRP-2 could bind mRNA, rRNA or both, and if it binds mRNA, it could just as well be involved in translation initiation as in light-regulated translation Fig Cytoplasmic precursors and complete mature forms: the nucleotide sequences of PSRP-2, PSRP-3 and PSRP-4 cDNAs and correlating experimentally determined peptide sequences Initiation contexts conforming to the Kozak rule [91] are boxed Chloroplast-targeting signal sequences (transit peptides) are shown in italics Arrows indicate the cleavage site of the transit peptide The experimentally determined N-terminal sequences and internal peptides are underlined The stop codon is indicated by an asterisk (A)n, polyadenylation Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 197 Fig Sequence alignment of PSRP-2 with three chloroplast RNA-binding proteins: domain arrangement/comparison of RBDs between PSRP-2 and RBD-containing proteins (A) PSRP-2 is aligned with three chloroplast RNA-binding proteins (cp29, cp31 and cp33, from wood tobacco, Nicotiana sylvestris [44,45]), to which it is closely related in structure, having two RBDs in similar arrangement The octapeptide RNP1 and the hexapeptide RNP2 motifs in each of the two RBDs are boxed Negatively charged amino acids (D/E) in the acidic N-terminal region of cpRNPs are shown in bold letters Identical amino acids or conserved replacements in the four proteins are shown shaded Chain lengths of the mature proteins and percentage identity (I) and similarity (S) are indicated after the C-terminus (B) Schematic diagram of RBD domain arrangement (filled boxes) in PSRP-2 and six other RBD-containing proteins Abbreviations and accession numbers: cpRNP, chloroplast ribonucleoprotein 28RNP from spinach (P28644); GRP, cold-inducible glycine-rich RNA-binding protein from barley (U49482); cyRBP, RNA-binding protein from a cyanobacterium, A variabilis (I39621); PABP, poly(A)-binding protein from an alga, C reinhardtii (T07933); hnRNP, heterogeneous nuclear ribonucreoprotein A1 from human (P09651); snRNP, small nuclear ribonucleoprotein U1A spliceosomal protein from human (P09012) (C) Alignment of the  50-amino-acid sequence portion of RBD-1 and RBD-2 from PSRP-2 and the six other RBD-containing proteins in (B) The positions of conserved amino-acid residues are highlighted: black, identical, and grey, similar Ó FEBS 2003 198 K Yamaguchi and A R Subramanian (Eur J Biochem 270) PSRP-3 and the hypothetical chloroplast reading frame (ycf65) protein A BLAST search of the PSRP-3 sequence against database sequences showed several close homologues They were all unidentified hypothetical proteins, designated YCF65 (hypothetical chloroplast frame 65 product [47]), first reported in the chloroplast genome of Porphyra purpurea, a red alga [48] Homologous sequences are present in the prasinophycean alga, Mesostigma viride, and the cryptophyte alga, Guillardia theta The ycf65 gene is absent from the chloroplast genome of the green algae Chlorella vulgaris [49] and C reinhardtii (J Maul, J W Lilly and D B Stern, unpublished results, www.biology.duke.edu/chlamy_ genome/chloro.html) However, a PSRP-3 homologue can be identified in the Chlamydomonas expressed sequence tag (EST) sequences (Table 2), suggesting a relocation of the ycf65 gene to the nuclear genome of C reinhardtii A homologue of the Psrp-3/ycf65 gene is absent from the database of eubacterial (nonphotosynthetic) and archaebacterial genomes However, a Psrp-3 homologue is present in the two (photosynthetic) cyanobacterial genomes (Synechocystis and Synechococcus) in the database Although not yet experimentally shown, it is likely that the PSRP-3 protein is a component of cyanobacterial ribosomes The overall sequence identities among higher plant PSRP-3 homologues are high (71–80%), whereas those between higher plant and algal/cyanobacterial PSRP-3 homologoues are lower (41–52%) The PSRP-3 sequences contain five invariant residues which are the relatively rare tryptophan, and, moreover, a highly conserved decapeptide motif, -Y(Y/F)FWPRXDAW-, containing five conserved aromatic amino acids, is present in the central region (Fig 6) Compared with the algal and cyanobacterial sequences, the mature spinach PSRP-3 carries a negatively charged N-terminal extension and a  20-residue truncation at the C-terminus It is likely that the Psrp-3 gene, having had its origins in the cyanobacterial genome, was retained during the emergence of algal/higher plant chloroplasts As PSRP-3 is specifically associated with ribosomes that have to perform protein synthesis in a photosynthetic environment, it may have been evolved for a role that does not exist in E coli, e.g linking protein synthesis and light Spinach PSRP-3 coexists in two forms, a form post-translationally modified at the N-terminus and an unmodified form It is not known if the ratio of these two forms is constant under all conditions The ratio could be variable, depending on the intensity and duration of light, like the growth ratedependent N-terminal modification in certain E coli ribosomal proteins [50] It would be interesting to identify the plant gene for the enzyme that catalyzes PSRP-3 posttranslational modification, and to check whether the cyanobacterial genome carries a homologous enzyme gene Sequence homology of PSRP-4 with Thermus thermophilus 30S subunit protein Thx and a plant mitochondrial protein From the incomplete sequence data then available [36,51], the T thermophilus 30S ribosomal protein ÔThxÕ was previously identified as a homologue of PSRP-4 protein (it was then designated S31) Recently the complete sequence of Thx, having only 26 residues, has been confirmed by nucleotide sequencing [52] Figure shows the sequence alignment A search using BLAST revealed two PSRP-4 homologues in the complete genome of Arabidopsis One of them was very closely related to the PSRP-4 sequence (chromosomal locus number AT2g38140), and so we obtained the corresponding EST (clone 122F4T7) from the Arabidopsis EST Stock Center and sequenced it completely (see accession number AF236826 for sequence data) The data revealed the cDNA of the PSRP-4 precursor protein of Arabidopsis chloroplast ribosome (see Fig 7A) The other homologue was a hypothetical protein, named here AthPSRP-4h (chromosomal locus AT2g2129), with less PSRP4 homology A transcript of this hypothetical protein was not identifiable in the Arabidopsis EST database However, sequences closely related to it are found in the ESTs of other plants, the closest one being a maize EST sequence The PSRP-4 precursor sequences from spinach (SolPSRP-4), Arabidopsis (AthPSRP-4) and tomato (LesPSRP4) are aligned in Fig 7A with the T themophilus Thx, and included there are the PSRP-4h hypothetical proteins from Arabidopsis and maize The PSRP-4 precursors carry plastid transit peptides of  50 amino-acid residues The mature PSRP-4 proteins have (a) lysine/arginie-rich Thx-like regions, (b) hydrophobic proline-rich motifs, and (c) nonconserved C-terminal regions The PSRP-4h hypothetical proteins have shorter putative transit peptides, but contain lysine/arginine-rich Thx-like regions, and conserved, hydrophobic, proline-rich C-terminal regions (-PWPLPFKLI-COOH) Table Homologues of spinach PSRPs in other angiosperms, a bryophyte, green alga, and photosynthetic bacterium Accession numbers are in parentheses Chromosomal locus of Arabidopsis genes are shown in square brackets EST, in italic ?, Significant homologues not found in public database, NI, not identified in the complete genome sequence Spinach Arabidopsis Barley Moss C reinhardtii Synechocystis PSRP-1 (M55322) PSRP-2 (AF240462) PSRP-3 (AF239218) AF370148 [AT5g24490] AY039568 [AT3g52150] AV530526 [AT1g68590] ? [AT5g15760] AF236826 [AT2g38140] BE037671 [AT3g56910] AV532737 [AT5g17870] BF262651 BF267982 AW201242 AW561215 ? Z98114 AV390148 ? BG847093 P74518 NI Q55385 BE558713 BF621665 BG300387 AW598994 AW509867 AW126633 BE452645 ? AV622927 NI NI NI PSRP-4 (AF236825) PSRP-5 (AF261940) PSRP-6 (AF245292) Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 199 Fig Sequence alignment of spinach PSRP-3 with algal ycf65 gene product and with homologues from higher plants and cyanobacteria Aligned sequences (and accession numbers) are: Arabidopsis (1: AT1g8590 and 2: AT5g15760, see also Table and text), barley (AW201241); YCF65 gene products from P purpurea (P51351); Guillardia theta (O78422); and Mesostigma viride (AAF43868); YCF65-like hypothetical proteins from Synechococcus PCC7942 (O05161) and Synechocystis PCC6803 (Q55385) The positions of conserved residues are highlighted: black, identical, and grey, similar The hypothetical AthPSRP-4h and ZmaPSRP-4h sequences were predicted to be chloroplast proteins by the ChloroP program [53], but on the other hand, the PSORT program [54] predicted them as mitochondrial matrix proteins or nuclear proteins It has been suggested that an N-terminal amphiphilic helix is a critical determinant for mitochondrial sorting [55], and recent NMR structures of mitochondrial and plastid transit peptides [56,57] have shown a significant difference in their secondary structures, i.e mitochondrial transit peptides have an N-terminal a-helix region, but plastid transit peptides have a nonhelical N-terminal region Secondarystructure prediction of the N-terminal regions of AthPSRP-4h and ZmaPSRP-4h showed arginine-containing amphiphilic helices like those of known mitochondrial transit peptides, whereas the N-termini of PSRP-4 precursors were predicted to be nonhelical structures (Fig 7A) Therefore, although the possibility of Nterminal extended PSRP-4 homologues in the cytoplasm or in the nuclear matrix cannot be ruled out, we suggest that the PSRP-4h hypothetical proteins are probably mitochondrial proteins Thx has been visualized in the crystal structure of T thermophilus 30S ribosomal subunit [58] It fits into the cavity found between the 16S rRNA helices H30, H41, H41a, H42, and H43 at the top of the 30S ÔheadÕ, the high positive charge of Thx stabilizing the organization of the RNA elements [58] These rRNA helices are also conserved in the plastid 16S rRNA Therefore, we suggest that PSRP-4 is most likely located at the top of the chloroplast 30S subunit head, with the Thx-like N-terminal sequence anchoring it to the ribosome The sequence homology between a Thermus ribosomal protein and the higher plant PSRP-4 requires a comment A Thx homologue is not identifiable in the genome sequences of not only E coli and other mesophilic bacteria, but also in the genomes of other thermophilic bacteria such as Aquifex aelolicus and Thermotoga maritima Thus, the unusual sequence resemblance between Thx and PSRP-4 may be due to a convergent evolution, i.e PSRP-4 and Thx genes may have arisen independently acquiring a similar function (stabilization of the rRNA helices) Another possibility is that PSRP-4 emerged during chloro-ribosome evolution by a process of gene capture (by horizontal gene transfer) from the progenitors of T thermophilus Whatever its origin, experiments transforming E coli with Thx or PSRP-4 gene would probably address the questions of thermal stability and function The two PSRPs on the chloroplast large ribosomal subunit, PSRP-5 and PSRP-6, are also highly basic, positively charged, small proteins (Table 1) Although these proteins not share significant sequence similarity, they share certain structural characteristics with PSRP-4 Figure 7B shows the sequences of PSRP-4, PSRP-5c (the shortest form of PSRP-5 [2]), PSRP-6 and Thx (manually aligned) and the schematic diagram of a discernible consensus secondary structure, composed of an N-terminal lysine/arginine-rich domain, a hydrophobic proline-rich motif, and a nonconserved C-terminal region The basic N-terminal domains of PSRP-5 and PSRP-6 may also serve 200 K Yamaguchi and A R Subramanian (Eur J Biochem 270) Ó FEBS 2003 Fig Sequence alignment of PSRP-4 with mitochondrial proteins and T thermophilus Thx Apparent structural similarity of PSRP-4 to PSRP-5 and PSRP-6 (A) Alignment of the transit peptide sequences of pre-PSRP-4 and six other similar precursors It is followed by the alignment of the mature proteins and Thx Predicted secondary structures in the aligned sequences are presented: a-helix, grey; b-sheet, open box; and b-turns, underlined Mitochondrial transit peptides of maize superoxide dismutase (ZmaMitoSD) and rice mitochondrial RPS11 (OsaMitoRPS11) are shown Conserved amino-acid residues, in bold letters (B) Sequence alignment of Thx, PSRP-4, PSRP-5c form, and PSRP-6 Basic amino acids lysine (light grey) and arginine (dark grey) are highlighted A schematic representation of the shared secondary structure is shown under the alignment, with the ribosome-binding site of Thx indicated (determined in crystal structure) Accession numbers are: AthPSRP-4 (AF236826), LesPSRP-4 (AW094412), AthPSRP-4h (AAD23677), ZmaPSRP-4h (AI667826), Thx (P32193), ZmaMitoSD (C48684), and OsaMitoRPS11 (T03690) LesPSRP-4 and ZmaPSRP-4h sequences were obtained from assembled ESTs to anchor these proteins on the ribosome, just as Thx does in Thermus ribosomes [58] In eukaryotic signal transduction, hydorophobic prolinerich motifs, such as shown in Fig 7B, have been identified as the ligands of SH3 domain-containing modulator proteins [59] Thus, these three small PSRPs in the two chloroplast ribosomal subunits, with their hydrophobic proline-rich motifs anchored on the ribosome by the N-terminal basic domains, may have the function of providing accessible sites for nonribosomal factors specific to the photosynthetic organelle The six PSRPs of spinach chloro-ribosome are identifiable in other higher plants but not always in lower plants and cyanobacteria The work reported in this paper completes the identification and sequence characterization of all the six PSRPs in a higher plant chloro-ribosome (Table 1) In terms of protein character PSRPs can be divided into two groups: (a) acidic proteins, PSRP-1, PSRP-2 and PSRP-3; (b) small/basic proteins, PSRP-4, PSRP-5 and PSRP-6 They can also be divided into two groups in terms of their post-translational modifications: PSRP-1, PSRP-2, PSRP-4 and PSRP-6 occurring without post-translational modification (other than transit peptide cleavage/removal), and PSRP-3 and PSRP-5 occurring post-translationally modified, PSRP-3 in two forms (this paper) and PSRP-5 in three forms [2] As we reported previously, post-translational modifications also occur in at least 14 other chloro-ribosomal proteins: (PRP-) S1a/b, S5 (uncharacterized N-terminal modification), S6ae, S9 (a-N-acetylation), S10a/b, S14a/b, S18a/b, S19a/b, L2 (a-N-monomethylation), L10a-c, L11 (e-trimethylations of Lys9 and Lys45), L16 (a-N-monomethylation), L18a/b, and L31a-c [1,2] Many of these specific modifications are not observed in the corresponding E coli orthologues Thus, the evolution of chloroplast ribosome involved not only the PSRPs but many enzymes that are needed for the posttranslational modifications unique to this ribosome All six PSRPs are encoded in the nuclear genome and are synthesized as precursor forms in the cytosol, carrying transit peptides that target them to the chloroplast envelope for import into the organelle The six PSRP genes (Psrp) could be identified in the complete genome sequence of A thaliana, with the gene loci distributed in four of the five chromosomes (i.e except IV) All Psrp genes are present as a single copy, except for PSRP-3 for which two homologous sequences are identifiable on chromosome I and chromosome V (AT1g68590, Arabidopsis1 and AT5g15760, Arabidopsis2, in Fig 6) However, while the transcript of Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 201 AT1g68590 is present as an EST clone, that of AT5g15760 has not been reported Thus, AT5g15760 (chromosome V) could be a pseudo-gene or a relatively silent gene that is transcribed under unusual circumstances Homologues of all the six Psrps are identifiable in the ESTs of other different higher plants and a bryophyte As representatives, Arabidopsis, barley and moss ESTs are listed in Table PSRP-1 and PSRP-3 protein genes could be identified in the genome sequence of a photosynthetic bacterium (Table 2) Table includes PSRP-2 homologous proteins showing the highest similarity score It is unclear whether PSRP-2 counterparts are present in the moss, C reinhardtii, and Synechocystis PSRP-5 homologues are also missing from the available data for the green alga C reinhardtii, but further accumulation of EST data and/or the complete genome sequence must be awaited for a final decision Another uncertain point is whether PSRP homologues identifiable in the lower plants, algae and photosynthetic bacteria are true ribosomal proteins A PSRP-1 homologue has been immunologically detected in C reinhardtii ribosomes [35] Several Ôphase-specificÕ ribosome-associated proteins in E coli (YfiA, YhbH, SRA, RMF, ÔS22Õ) have recently been reported [60–64] PSRP-1 has weak similarity to YfiA and YhbH proteins, whereas other PSRPs have no sequence homology with these or any other E coli proteins Regulation of chloroplast protein synthesis and the evolution of PSRPs The primary function of ribosome is to be the platform on which mRNA, tRNA and the various protein synthesis factors sequentially assemble to perform their functions with acceptable decoding accuracy and speed, and to catalyze the peptide bond synthesis The crystal structure of the Haloarcula marismortui large ribosomal subunit, at ˚ 2.4 A resolution, revealed the peptidyl transferase center to be composed of only rRNA [65,66] The specific functions of the individual ribosomal proteins are still unknown in most cases The E coli orthologues of the chloro-ribosome (all except L25 and L30 are represented in the chloro-ribosome) probably perform functions similar to that in the E coli ribosome On the other hand, the PSRPs of the chloro-ribosome would have been evolved, in the energy-rich photosynthetic organelle, to perform different functions These may include regulating protein synthesis in a more global manner, e.g responding to the diurnal light and dark cycle and the consequent rapidly changing ATP/GTP levels in the organelle, and meeting the high synthetic needs of certain rapidly turning over proteins of the photosystems The human mitochondrial ribosome has 29 distinct proteins in the small subunit, 14 E coli orthologues and 15 mitochondrion-specific ribosomal proteins [67] The plastid 30S ribosomal subunit, on the other hand, has only 25 proteins, including all 21 of the E coli orthologues and PSRPs Thus, whereas mammalian mito-ribosomes are highly divergent from bacterial ribosome, the plastid ribosome has apparently maintained its bacterial-type building blocks while acquiring additional proteins for specific new translational regulatory functions The additional ribosomal proteins seem to have ribosome-binding sites similar to those of E coli For example, PSRP-1 expressed in E coli is readily assembled in E coli 30S subunits, 70S ribosomes and polysomes, and the incorporated PSRP-1 did not interfere with protein synthesis [35] Light-activated translation of psbA mRNA has been extensively investigated in the green alga, C reinhardtii A light-activated translational initiation model has been proposed, based on the characteristics of psbA mRNA 5¢-UTR-binding proteins which are modulated in a lightdependent manner, e.g sensing redox potential and ATP/ ADP ratio [7,8,68] A model for light-regulated translation activation has been proposed in C reinhardtii via a specific interaction between psbA mRNA 5¢-UTR and RB47, a chloroplast poly(A)-binding protein [40,69] In tobacco chloroplast, most mRNAs encoding photosynthesis-related proteins (psbA, rbcL, petD) occur ribosome free, and they accumulate as stable mRNA–cpRNP complexes [70,71] In barley, it has been reported that there is a light-induced increase in psbA mRNA abundance in membrane polysomes, and a shift of psbA mRNA into larger polysomes, suggesting light activation of translation initiation [72] It is not known, and a model has not been proposed so far, on how plastid ribosomes actually recognize light-activated mRNA We have proposed that PSRPs in the chloro-30S may form one or more Ôplastid-specific translation regulatory modulesÕ [2] Here we represent a working model for lightactivated translation initiation (Fig 8), via such a plastidspecific translation regulatory module, involving mainly PSRP-2 In the dark, cpRNPs would bind mRNAs to stabilize and protect them from nucleases [71] and to prevent their association with 30S subunits Spinach 28RNP can be phosphorylated at its acidic N-terminal domain [73] The RNA-binding affinity of the phosphorylated protein is reduced three- to fourfold in vitro compared with the nonphosphorylated form [73] In the presence of light, cpRNP would be phosphorylated at its N-terminal acidic domain (and/or modulated by protein factors), weakening the cpRNP–mRNA interaction, allowing PSRP-2, a cpRNP homologue lacking the N-terminal acidic domain Fig A model for light-activated translation regulation and the chlororibosome cycle Working model for light-activated translation initiation (see text for details) A hypothetical translation regulatory module (comprising mainly PSRP-2) is highlighted The positions of all PSRPs on spinach chloro-ribosome have been tentatively assigned using cryo-electron microscopy (R Agrawal, personal communication) Circled P stands for phosphorylation or protein factor association pRRF, plastid ribosome recycling factor 202 K Yamaguchi and A R Subramanian (Eur J Biochem 270) (Fig 5), to take over the mRNA from the cpRNP–mRNA complex on the ribosome (Fig 8) Photosynthetic bacteria possess several RNA-binding proteins that have no counterparts in E.coli, as well as a nonribosomal nucleic acid-binding protein similar to E coli S1 (Nbp1), and the ribosomal orthologue of ribosomal protein S1 [74] Higher plant chloroplasts possess cpRNPs and other RNA-binding proteins [41,44,45] These nonribosomal RNA-binding proteins in photosynthetic bacteria and plant chloroplasts are likely to be required as transcript mediators and stabilizers of mRNA, until the latter is able to bind, in the illuminated state, to the small chloro-subunit (Fig 8) It is possible that the PSRP-2 binding of mRNA involves co-operation with the plasid ribosomal protein S1 E coli S1 protein (61 kDa) consists of six S1 motifs, each comprising  70 amino-acid residues [75] The two Nterminal motifs are involved in ribosome binding, and three of the C-terminal domains are required for mRNA recognition [6,75,76], with the last domain involved in the autoregulation of S1 mRNA [77] Cyanobacterial and chloro-S1 orthologues are truncated proteins ( 40 kDa), and have essentially only a total of three S1 motifs, thus showing similarity to only the N-terminal half of E coli S1 [74,78] Spinach chloro-S1 has been shown to associate with the psbA mRNA 5¢-UTR [79], and the RNA-binding site has been reported to be in the C-terminal half of the molecule [80] Recently, S1 protein mass has been visualized in the cryo-electron microscopic map of the E coli ribosome [81] S1 protein interacts with the 11 A/U-rich nucleotides immediately upstream of the Shine-Dalgarno sequence, at the junction of the head platform and the body of the small subunit [81] Most E coli mRNAs have Shine–Dalgarno sequences that are 2–7 nucleotides upstream from the initiation codon, and this position is critical [82] On the other hand, photosynthetic bacterial and chloro-mRNAs have Shine– Dalgarno-like sequences up to 30 nucleotides upstream from the initiation codon or are often even missing [83] Using a tobacco in vitro translation system, Hirose & Sugiura [18] have proposed formation of a factor-mediated translation initiation complex at the 5¢-UTR of psbA mRNA As regulation of translation initiation is likely to occur at or near the S1 protein and the trans-factors and ciselements in the 5¢-UTR of plastid mRNAs, PSRP-2 may be located adjacent to the truncated plastid S1, complementing the binding affinity at the 5¢-UTR of light-activated mRNA (Fig 8) Recently, significant progress has been made using cryo-electron microscopy, to establish the 3D positions of the PSRPs in the spinach chloro-ribosome (R Agrawal, personal communication) A second possible light-activated pathway for chloroplast translation initiation could be through chloro-ribosome dissociation/association equilibrium (Fig 8) We have identified stoichiometric amounts of the chloroplast ribosome recycling factor (pRRF) in the plastid 70S ribosome [2] and have proposed that pRRF acts as a de facto antidissociation factor [2] Thus, after translation termination and release of mRNA/tRNA through RRF-mediated GTP hydrolysis, chloro-ribosome is likely to be present as a stable ribosome– pRRF complex In this context, the activity of Euglena gracilis chloro-initiation factor-3 (pIF-3) is reported to be Ó FEBS 2003  100-fold modulated by the presence or absence of its chloroplast-specific N-terminal and C-terminal extensions [84] It is important to recall that IF-3 was initially discovered as a ribosome dissociation factor [85] If chloro-IF-3 is activated by illumination to dissociate the stable ribosome–pRRF complex, this pathway of lightactivated translation initiation may provide a second regulatory loop for chloroplast protein synthesis (Fig 8) Possible nonribosomal functions for PSRPs PSRPs are unitary constituents of the chloro-ribosome, as they are present in the same stoichiometry as the chloroorthologues of E coli ribosomal proteins [1,2] However, PSRP-1 has been reported to be present in a free state, at a high concentration, in the chloroplast stromal fluid [20] Thus multiple organelle functions for this protein are indicated Interestingly, PSRP-1 shows significant sequence similarity to a host of unusual nonribosomal proteins: e.g the light-repressed transcript (LrtA) of Synechococcus and bacterial transcription modulator protein sigma 54 [86] There are several examples of E coli ribosomal proteins sharing functions in the transcription machinery: ribosomal protein S10 is also known as transcription antitermination protein NusE [87], and recent reports suggest that ribosomal proteins S4, L3, L4, and L13 are also involved in the E coli antitermination transcription complex [88] Ribosomal protein S1 has long been known to be a required component of the replicase enzyme of E coli RNA phages [75] Many of the human and animal cytosolic ribosomal proteins have been suggested to perform a wide variety of ÔextraribosomalÕ functions in the cell (reviewed in [89]) Recently, PSRP-1 has been copurified with chloroplast RNase P, suggesting its possible participation in organelle RNA processing (P Gegenheimer, personal communication) As described above, PSRP-2 has sequence similarity to a large group of RNAbinding proteins involved in mRNA processing, and we have made use of this finding in our proposed general model for PSRP function (Fig 8) A correlation between the processing of psbA mRNA 5¢-UTR and ribosome association in Chlamydomonas has been reported [90] Thus, it appears possible that PSRPs, either in free form or on the ribosomal subunits, may be involved in certain nontranslational functions in photosynthetic organelles Acknowledgements We thank Klaus von Knoblauch for skilful technical assistance The research at the University of Arizona was supported by the MaxPlanck Gesellschaft through a Sponsored Research Grant to A.R.S (Protein Synthesis and Regulation) We would like to dedicate this paper to the memories of Bernard D Davis, Herman M Kalckar and Heinz-Guenter Wittmann (senior colleagues of A.R.S.), and recall their contributions on antibiotics, ATP/GTP, and protein biosynthesis References Yamaguchi, K., von Knoblauch, K & Subramanian, A.R (2000) The plastid ribosomal proteins: Identification of all the proteins in the 30S subunit of an organelle ribosome (chloroplast) J Biol Chem 275, 28455–28465 Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 203 Yamaguchi, K & Subramanian, A.R (2000) The plastid ribosomal proteins: Identification of all the proteins in the 50S subunit of an organelle ribosome (chloroplast) J Biol Chem 275, 28466– 28482 Subramanian, A.R., Stahl, D & Prombona, A (1990) Ribosomal proteins, ribosomes, and translation in plastids In: The Molecular Biology of Plastids (Bogorad, L & Vasil, I.K., eds), pp 191–215 Academic Press, New York, USA Subramanian, A.R (1993) Molecular genetics of chloroplast ribosomal proteins Trends Biochem Sci 18, 177–180 Harris, E.H., Boynton, J.E & Gillham, N.W (1994) Chloroplast ribosomes and protein synthesis Microbiol Rev 58, 700–754 Subramanian, A.R (1985) The ribosome: Its evolutionary diversity and the functional role of one of its components Essays Biochem 21, 45–85 Mayfield, S.P., Yohn, C.B., Cohen, A & Danon, A (1995) Regulation of chloroplast gene expression Annu Rev Plant Physiol Plant Mol Biol 46, 147–166 Somanchi, A & Mayfield, S.P (2001) Regulaion of chloroplast translation In Advances in Photosynthesis and Respiration, Vol 11 Regulation of Photosynthesis (Aro, E.-M & Andersson, B., eds), pp 137–151 Kluwer Academic Publishers, the Netherlands Rochaix (1992) Post-transcriptional steps in the expression of chloroplast genes Annu Rev Cell Biol 8, 1–28 10 Herrmann, R.G., Westhoff, P & Link, G (1992) Biogenesis of plastids in higher plants In Advances in Plant Gene Research, Vol VI Cell Organelles (Herrmann, R.G., ed.), pp 276–349 SpringerVerlag, Berlin, Germany 11 Gruissem, W & Tonkyn, J.C (1993) Control mechanisms of plastid gene expression Crit Rev Plant Sci 12, 19–55 12 Mullet, J.E (1993) Dynamic regulation of chloroplast transcription Plant Physiol 103, 309–313 13 Sugita, M & Sugiura, M (1996) Regulation of gene expression in chloroplasts of higher plants Plant Mol Biol 32, 315–326 14 Barkan, A & Goldschmidt-Clermont, M (2000) Participation of nuclear genes in chloroplast gene expression Biochimie 82, 559–572 15 Hirose, T & Sugiura, M (2001) Involvement of a site-specific trans-acting factor and a common RNA-binding protein in the editing of chloroplast mRNAs: development of a chloroplast in vitro RNA editing system EMBO J 20, 1144–1152 16 Staub, J.M & Maliga, P (1993) Accumulation of D1 polypeptide in tobacco plastids is regulated via the untranslated region of the psbA mRNA EMBO J 12, 601–606 17 Berry, J.O., Breiding, D.E & Klessig, D.F (1990) Light-mediated control of translational initiation of ribulose-1,5-bisphosphate carboxylase in amaranth cotyledons Plant Cell 2, 795–803 18 Hirose, T & Sugiura, M (1996) Cis-acting elements and transacting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system from tobacco chloroplasts EMBO J 15, 1687–1695 19 Barber, J (1998) Photosystem two Biochim Biophys Acta 1365, 269–277 20 Zhou, D.X & Mache, R (1989) Presence in the stroma of chloroplasts of a large pool of a ribosomal protein not structurally related to any Escherichia coli ribosomal protein Mol General Genet 219, 204–208 21 Johnson, C.H., Kruft, V & Subramanian, A.R (1990) Identification of a plastid-specific ribosomal protein in the 30 S subunit of chloroplast ribosomes and isolation of the cDNA clone encoding its cytoplasmic precursor J Biol Chem 265, 12790–12795 22 Gantt, J.S (1988) Nucleotide sequences of cDNAs encoding four complete nuclear-encoded plastid ribosomal proteins Curr Genet 14, 519–528 23 Bartsch, M., Kimura, M & Subramanian, A.R (1982) Purification, primary structure, and homology relationships of a chloro- 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 plast ribosomal protein Proc Natl Acad Sci USA 79, 6871– 6875 Laemmli, U.K (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 Subramanian, A.R (1974) Sensitive separation procedure for Escherichia coli ribosomal proteins and the resolution of highmolecular-weight components Eur J Biochem 45, 541–546 Schagger, H & von Jagow, G (1987) Tricine-sodium dodecyl ă sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from to 100 kDa Anal Biochem 166, 368– 379 Hellman, U., Wernstedt, C., Gonez, J & Heldin, C.H (1995) Improvement of an ÔIn-GelÕ digestion procedure for the micropreparation of internal protein fragments for amino acid sequencing Anal Biochem 224, 451–455 Giese, K & Subramanian, A.R (1989) Chloroplast ribosomal protein L12 is encoded in the nucleus: construction and identification of its cDNA clones and nucleotide sequence including the transit peptide Biochemistry 28, 3525–3529 Sambrook, J., Fritsch, E.F & Maniatis, T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA G.C.G (1998) Wisconsin Package, Version 10.0 Genetics Computer Group, Madison, Wisconsin, USA Thompson, J.D., Higgins, D.G & Gibson, T.J (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673– 4680 Chou, P.Y & Fasman, G.D (1978) Empirical predictions of protein conformation Annu Rev Biochem 47, 251–276 Garnier, J., Levin, J.M., Gibrat, J.F & Biou, V (1990) Secondary structure prediction and protein design Biochem Soc Symp 57, 11–24 Price, C.A., Reardon, E.M & Lonsdale, D.M (1996) A guide to naming sequenced plant genes Plant Mol Biol 30, 225–227 Bubunenko, M.G & Subramanian, A.R (1994) Recognition of novel and divergent higher plant chloroplast ribosomal proteins by Escherichia coli ribosome during in vivo assembly J Biol Chem 269, 18223–18231 Schmidt, J., Srinivasa, B., Weglohner, W & Subramanian, A.R ă (1993) A small novel chloroplast ribosomal protein (S31) that has no apparent counterpart in the E coli ribosome Biochem Mol Biol Int 29, 25–31 Schmitz-Linneweber, C., Maier, R.M., Alcaraz, J.P., Cottet, A., Herrmann, R.G & Mache, R (2001) The plastid chromosome of spinach (Spinacia oleracea): complete nucleotide sequence and gene organization Plant Mol Biol 45, 307–315 Sugiura, M (1992) The chloroplast genome Plant Mol Biol 19, 149–168 Oubridge, C., Ito, N., Evans, P.R., Teo, C.H & Nagai, K (1994) ˚ Crystal structure at 1.92 A resolution of the RNA-binding domain of the U1A spliceosomal protein complexed with an RNA hairpin Nature 372, 432–438 Yohn, C.B., Cohen, A., Danon, A & Mayfield, S.P (1998) A poly (A) binding protein functions in the chloroplast as a messagespecific translation factor Proc Natl Acad Sci USA 95, 2238– 2243 Dunn, M.A., Brown, K., Lightowlers, R & Hughes, M.A (1996) A low-temperature-responsive gene from barley encodes a protein with single-stranded nucleic acid-binding activity which is phosphorylated in vitro Plant Mol Biol 30, 947–959 Buvoli, M., Biamonti, G., Tsoulfas, P., Bassi, M.T., Ghetti, A., Riva, S & Morandi, C (1988) cDNA cloning of human hnRNP protein A1 reveals the existence of multiple mRNA Nucleic Acids Res 16, 3751–3770 204 K Yamaguchi and A R Subramanian (Eur J Biochem 270) 43 Query, C.C., Bentley, R.C & Keene, J.D (1989) A common RNA recognition motif identified within a defined U1 RNA binding domain of the 70K, U1 snRNP protein Cell 57, 89–101 44 Li, Y.Q & Sugiura, M (1990) Three distinct ribonucleoproteins from tobacco chloroplasts: each contains a unique amino terminal acidic domain and two ribonucleoprotein consensus motifs EMBO J 9, 3059–3066 45 Ye, L.H., Li, Y.Q., Fukami-Kobayashi, K., Go, M., Konishi, T., Watanabe, A & Sugiura, M (1991) Diversity of a ribonucleoprotein family in tobacco chloroplasts: two new chloroplast ribonucleoproteins and a phylogenetic tree of ten chloroplast RNA-binding domains Nucleic Acids Res 19, 6485–6490 46 Maruyama, K., Sato, N & Ohta, N (1999) Conservation of structure and cold-regulation of RNA-binding proteins in cyanobacteria: probable convergent evolution with eukaryotic glycine-rich RNA-binding proteins Nucleic Acids Res 27, 2029–2036 47 Stoebe, B., Martin, W & Kowallik, K.V (1998) Distribution and nomenclature of protein-coding genes in 12 sequenced chloroplast genomes Plant Mol Biol Report 16, 243–255 48 Reith, M.E & Munholland, J (1995) Complete nucleotide sequence of the Porphyra purpurea chloroplast genome Plant Mol Biol Report 13, 333–335 49 Wakasugi, T., Nagai, T., Kapoor, M., Sugita, M., Ito, M., Ito, S., Tsudzuki, J., Nakashima, K., Tsudzuki, T., Suzuki, Y., Hamada, A., Ohta, T., Inamura, A., Yoshinaga, K & Sugiura, M (1997) Complete nucleotide sequence of the chloroplast genome from the green alga Chlorella vulgaris: the existence of genes possibly involved in chloroplast division Proc Natl Acad Sci USA 94, 5967–5972 50 Ramagopal, S & Subramanian, A.R (1974) Alteration in the acetylation level of ribosomal protein L12 during the growth cycle of Escherichia coli Proc Natl Acad Sci USA 71, 2136–2140 51 Tsiboli, P., Herfurth, E & Choli, T (1994) Purification and characterization of the 30S ribosomal proteins from the bacterium Thermus thermophilus Eur J Biochem 226, 169–177 52 Leontiadou, F., Triantafillidou, D & Choli-Papadopoulos, T (2001) On the characterization of the putative S20-Thx operon of Thermus thermophilus Biol Chem 382, 1001–1006 53 Emanuelsson, O., Nielsen, H & von Heijne, G (1999) ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites Protein Sci 8, 978–984 54 Nakai, K & Kanehisa, M (1992) A knowledge base for predicting protein localization sites in eukaryotic cells Genomics 14, 897–911 55 von Heijne, G (1986) Mitochondrial targeting sequences may form amphiphilic helices EMBO J 5, 1335–1342 56 Lancelin, J.M., Bally, I., Arlaud, G.J., Blackledge, M., Gans, P., Stein, M & Jacquot, J.P (1994) NMR structures of ferredoxin chloroplastic transit peptide from Chlamydomonas reinhardtii promoted by trifluoroethanol in aqueous solution FEBS Lett 343, 261–266 57 Lancelin, J.M., Gans, P., Bouchayer, E., Bally, I., Arlaud, G.J & Jacquot, J.P (1996) NMR structures of a mitochondrial transit peptide from the green alga Chlamydomonas reinhardtii FEBS Lett 391, 203–208 58 Wimberly, B.T., Brodersen, D.E., Clemons, W.M Jr, MorganWarren, R.J., Carter, A.P., Vonrhein, C., Hartsch, T & Ramakrishnan, V (2000) Structure of the 30S ribosomal subunit Nature 407, 327–339 59 Cohen, G.B., Ren, R & Baltimore, D (1995) Modular binding domains in signal transduction proteins Cell 80, 237–248 60 Agafonov, D.E., Kolb, V.A., Nazimov, I.V & Spirin, A.S (1999) A protein residing at the subunit interface of the bacterial ribosome Proc Natl Acad Sci USA 96, 12345–12349 61 Maki, Y., Yoshida, H & Wada, A (2000) Two proteins, YfiA and YhbH, associated with resting ribosomes in stationary phase Escherichia coli Genes Cells 5, 965–974 Ó FEBS 2003 62 Izutsu, K., Wada, C., Komine, Y., Sako, T., Ueguchi, C., Nakura, S & Wada, A (2001) Escherichia coli ribosome-associated protein SRA, whose copy number increases during stationary phase J Bacteriol 183, 2765–2773 63 Wada, A., Yamazaki, Y., Fujita, N & Ishihama, A (1990) Structure and probable genetic location of a Ôribosome modulation factorÕ associated with 100S ribosomes in stationary-phase Escherichia coli cells Proc Natl Acad Sci USA 87, 2657–2661 64 Wada, A (1998) Growth phase coupled modulation of Escherichia coli ribosomes Genes Cells 3, 203–208 65 Ban, N., Nissen, P., Hansen, J., Moore, P.B & Steitz, T.A (2000) The complete atomic structure of the large ribosomal subunit at ˚ 2.4 A resolution Science 289, 905–920 66 Nissen, P., Hansen, J., Ban, N., Moore, P.B & Steitz, T.A (2000) The structural basis of ribosome activity in peptide bond synthesis Science 289, 920–930 67 Koc, E.C., Burkhart, W., Blackburn, K., Moseley, A & Spremulli, L.L (2001) The small subunit of the mammalian mitochondrial ribosome Identification of the full complement of ribosomal proteins present J Biol Chem 276, 19363–19374 68 Danon, A & Mayfield, S.P (1994) ADP-dependent phosphorylation regulates RNA-binding in vitro: implications in lightmodulated translation EMBO J 13, 2227–2235 69 Fong, C.L., Lentz, A & Mayfield, S.P (2000) Disulfide bond formation between RNA binding domains is used to regulate mRNA binding activity of the chloroplast poly(A)-binding protein J Biol Chem 275, 8275–8278 70 Nakamura, T., Ohta, M., Sugiura, M & Sugita, M (1999) Chloroplast ribonucleoproteins are associated with both mRNAs and intron-containing precursor tRNAs FEBS Lett 460, 437– 441 71 Nakamura, T., Ohta, M., Sugiura, M & Sugita, M (2001) Chloroplast ribonucleoproteins function as a stabilizing factor of ribosome-free mRNAs in the stroma J Biol Chem 276, 147–152 72 Kim, J & Mullet, J.E (1994) Ribosome-binding sites on chloroplast rbcL and psbA mRNAs and light-induced initiation of D1 translation Plant Mol Biol 25, 437–448 73 Lisitsky, I & Schuster, G (1995) Phosphorylation of a chloroplast RNA-binding protein changes its affinity to RNA Nucleic Acids Res 23, 2506–2511 74 Sugita, C., Sugiura, M & Sugita, M (2000) A novel nucleic acidbinding protein in the cyanobacterium Synechococcus sp PCC6301: a soluble 33-kDa polypeptide with high sequence similarity to ribosomal protein S1 Mol General Genet 263, 655– 663 75 Subramanian, A.R (1983) Structure and functions of ribosomal protein S1 Prog Nucleic Acid Res Mol Biol 28, 101–142 76 Subramanian, A.R (1984) Structure and functions of the largest Escherichia coli ribosomal protein Trends Biochem Sci 9, 491– 494 77 Boni, I.V., Artamonova, V.S & Dreyfus, M (2000) The last RNA-binding repeat of the Escherichia coli ribosomal protein S1 is specifically involved in autogenous control J Bacteriol 182, 5872–5879 78 Franzetti, B., Carol, P & Mache, R (1992) Characterization and RNA-binding properties of a chloroplast S1-like ribosomal protein J Biol Chem 267, 19075–19081 79 Alexander, C., Faber, N & Klaff, P (1998) Characterization of protein-binding to the spinach chloroplast psbA mRNA 5¢ untranslated region Nucleic Acids Res 26, 2265–2272 80 Shteiman-Kotler, A & Schuster, G (2000) RNA-binding characteristics of the chloroplast S1-like ribosomal protein CS1 Nucleic Acids Res 28, 3310–3315 81 Sengupta, J., Agrawal, R.K & Frank, J (2001) Visualization of protein S1 within the 30S ribosomal subunit and its interaction Ó FEBS 2003 82 83 84 85 86 87 Chloroplast-specific ribosomal proteins (Eur J Biochem 270) 205 with messenger RNA Proc Natl Acad Sci USA 98, 11991– 11996 McCarthy, J.E.G & Brimacombe, R (1994) Prokaryotic translation: the interactive pathway leading to initiation Trends Genet 10, 402–407 Sugiura, M., Hirose, T & Sugita, M (1998) Evolution and mechanism of translation in chloroplasts Annu Rev Genet 32, 437–459 Yu, N.J & Spremulli, L.L (1998) Regulation of the activity of chloroplast translational initiation factor by NH2- and COOHterminal extensions J Biol Chem 273, 3871–3877 Subramanian, A.R & Davis, B.D (1970) Activity of initiation factor F3 in dissociating Escherichia coli ribosomes Nature 228, 1273–1275 Tan, X., Varughese, M & Widger, W.R (1994) A light-repressed transcript found in Synechococcus PCC 7002 is similar to a chloroplast-specific small subunit ribosomal protein and to a transcription modulator protein associated with sigma 54 J Biol Chem 269, 20905–20912 Das, A., Ghosh, B., Barik, S & Wolska, K (1985) Evidence that ribosomal protein S10 itself is a cellular component necessary for transcription antiterminationby phage lambda N protein Proc Natl Acad Sci USA 82, 4070–4074 88 Torres, M., Condon, C., Balada, J.M., Squires, C & Squires, C.L (2001) Ribosomal protein S4 is a transcription factor with properties remarkably similar to NusA, a protein involved in both nonribosomal and ribosomal RNA antitermination EMBO J 20, 3811–3820 89 Wool, I.G (1996) Extraribosomal functions of ribosomal proteins Trends Biochem Sci 21, 164–165 90 Bruick, R.K & Mayfield, S.P (1998) Processing of the psbA 5¢ untranslated region in Chlamydomonas reinhardtii depends upon factors mediating ribosome association J Cell Biol 143, 1145– 1153 91 Kozak, M (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes Cell 44, 283–292 92 Bisanz-Seyer, C & Mache, R (1992) Organization and expression of the nuclear gene coding for the plastid-specific S22 ribosomal protein from spinach Plant Mol Biol 18, 337–341 93 Wada, A., Koyama, K., Maki, Y., Shimoi, Y., Tanaka, A & Tsuji, H (1993) A kDa protein (SCS23) from the 30 S subunit of the spinach chloroplast ribosome FEBS Lett 319, 115–118 94 Carol, P., Li, Y.F & Mache, R (1991) Conservation and evolution of the nucleus-encoded and chloroplast-specific ribosomal proteins in pea and spinach Gene 103, 139–145  ... c For cloning and sequencing of cDNA encoding full Results and discussion Identification, isolation, N-terminal/internal peptide sequencing and MS of PSRP-2, PSRP-3 and PSRP-4 Spinach chloroplast. .. actually to a small group of RNA-binding proteins (cpRNPs) present in the chloroplast stroma Other high-alignment hits were: polyadenylate-binding proteins, glycine-rich RNA-binding proteins, heterogeneous... protein S1 [74] Higher plant chloroplasts possess cpRNPs and other RNA-binding proteins [41,44,45] These nonribosomal RNA-binding proteins in photosynthetic bacteria and plant chloroplasts are