Ngày tải lên: 16/01/2014, 16:33
... the proposed synthetic trypsin inhibitor gene The sequences of the forward and reversed primers are shown on fig and of the synthetic gene is on fig Forward primer: GAATTCCATATGAGCGGCAGCGATGGCGGCGTGTGCCCGA ... of MCoTI-II gene on 5%polyacrylamide gel Lane 1: DNA Marker 100 bp (100-1031) (#SMO241/2/3) Lane : PCR product of MCoTI-II gene MCoTI-II gene was also successfully prepared by using forward , ... MCoTI-II gene was synthesized by four overlapping primers ,transformated into pTYB12 vector E.coli BL21(DE3) strain was used as the host for cloning and expression of the recombinant gene The...
Ngày tải lên: 12/02/2014, 10:20
Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc
... NirE_Compl _for (GAGAATTCGGA AATCGGCCTCG) and NirE_Compl_rev (CTAAGCTTT CAGGCGCATGCG) for the nirE gene and CobA_ and Compl _for (GAGAATTCACTGCTGGCGGCC) CobA_Compl_rev (CTAAGCTTTCAGGCGCTCAGGG) for the ... siroheme formation and therefore cannot provide this precursor for heme d1 biosynthesis in the absence of NirE The observation that CobA is apparently not able to replace NirE during heme d1 formation ... Europe (Carnforth, UK) Plasmids, bacteria and growth conditions The E coli strain DH10B was used as the host for cloning, and E coli BL21(DE3) was used as the host for protein production For complementation...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx
... had the potential for providing substrate for mitochondrial fatty acid oxidation by lipid hydrolysis [7], for generating lipid second messengers (eicosanoids and lysolipids), for modulating ion ... 241, 779–786 Luckow, V.A & Summers, M.D (1988) Signals important for high-level expression of foreign genes in Autographa californica nuclear polyhedrosis virus expression vectors Virology 167, ... cross-linked by exposure to a UV light source for 1.5 and then baked at 85 °C for 60 After prehybridization in ExpressHyb hybridization buffer (BD Biosciences) for 30 min, the blot was hybridized h at...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... transcriptional regulatory mechanisms Annu Rev Genet 29, 651–674 30 Hata K & Mizuguchi J (2004) Genomic organization and characterization of the promoter for the E2A gene Gene 325, 53–61 31 van Rietschoten ... centered at )105 that is critical for efficient basal Prm3-directed gene expression and have confirmed the ability of both Oct-1 and Oct-2 to bind and regulate Prm3-directed gene expression Identification ... DNA complex formation Similar data were generated in HEK293 cells (data not shown) Hence, we have identified a consensus AP-1 transcription factor site centered at )27 that is critical for efficient...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... belongs phylogenetically to the Gram-positive bacteria one would expect to find a type I SPase similar to the various sip genes However, no type I SPase typical for Gram-positive bacteria or for Gram-negative ... concerning gene size, gene copy number and substrate specificity, despite the substantial sequence similarities as indicated by six distinct regions with conserved amino acids [26] For instance, ... Y-scores (combined cleavage site score) are shown for each position in the sequence The data were generated by feeding the first 50 amino acids of the gene products of MPN142 to the publicly available...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
... occurred PCR-based site-directed mutagenesis was performed according to the method described by Weiner et al [32] The PCR was performed using pfu DNA polymerase (Stratagene) with K3S2 plasmid ()260/)119 ... start sites for the integrin a3 subunit gene, a modified method of 5¢-RACE using a cap site-labeled cDNA library was employed, recently developed for rapid examination of 5¢-end of genes [33] After ... usage for the generation of variants of the a3 subunits (a3A and a3B) [18] In the present study, we characterized the promoter region for this integrin receptor Most integrin a subunit genes...
Ngày tải lên: 21/02/2014, 03:20
Gene Selection for Cancer Classification using Support Vector Machines pot
... performance for various classifiers all trained with genes selected by the method of (Golub, 1999) In contrast, the SVM selected genes yield consistently better performance than the baseline genes ... or ALL There is therefore a lot of redundancy in this gene set In essence, all the genes carry the same information Conversely, the SVM selected genes carry complementary information This is reflected ... performance The best leave-one-out performance is 100% accuracy for the SVMs (SVM classifier trained on SVM genes) and only 90% for the baseline method (baseline classifier trained on baseline genes)...
Ngày tải lên: 06/03/2014, 00:22
Báo cáo khoa học: Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags doc
... synthesis Generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) To avoid the disadvantage mentioned above in the RAST-PCR method, Chen et al proposed a new method called generation ... developed: rapid RT-PCR analysis of unknown SAGE tags (RAST-PCR) [33], generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) [34], a high-throughput GLGI procedure [32], ... antisense primer for PCR will 2658 generate multiple fragments with different sizes or a smear caused by inclusion of various lengths of poly(dA) ⁄ (dT) sequences [34] The reason for this is that...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc
... splicing are other events that may be gene lengthdependent Mutants lacking subunits of the THO Assay for gene length-dependent mRNA biogenesis complex, involved in mRNP formation, show the lowest GLAM ... The Authors Journal compilation ª 2006 FEBS 757 Assay for gene length-dependent mRNA biogenesis M Morillo-Huesca et al A B C D Fig Influence of gene- length on mRNA accumulation (A) Transcription ... wild-type ratios and, therefore, we consider this percentage as the threshold value to indicate a deficiency in gene lengthdependent mRNA biogenesis TFIIS, encoded by the DST1 ⁄ PPR2 gene in S cerevisiae,...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Sequences downstream of the transcription initiation site are important for proper initiation and regulation of mouse ribonucleotide reductase R2 gene transcription ppt
... products were used for primer extension experiments The same primer, specific for the luciferase open-reading frame was used for all constructs Arrows indicate the position for the two major transcription ... promoter-luciferase reporter gene in stably transformed cells, even at high concentrations of polyamide We realized that we had taken for granted that the R2 TATA-box is essential for transcription initiation ... D (1996) The general transcription factors of RNA polymerase II Genes & Dev 10, 2657–2683 Lee, T.I & Young, R.A (2000) Transcription of eukaryotic protein-coding genes Annu Rev Genet 34, 77–137...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... directs transcription of a luciferase reporter gene in vitro The 5Â anking sequence of the xMGP gene is typical for a RNA polymerase II transcribed gene Immediately upstream from the transcription ... induction of reporter gene expression, further conrming the importance of the regulatory element for xMGP gene expression These data suggested the presence of specic binding sites for nuclear factors ... the rat matrix (MGP) gene in chondrogenesis and osteogenesis J Cell Biochem 46, 351365 ể FEBS 2002 35 Shanahan, C.M., Weissberg, P.L & Metcalfe, J.C (1993) Isolation of gene markers of dierentiated...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... the host for gene cloning and expression Luria–Bertani medium supplemented with 100 mgÆmL)1 ampicillin (Sigma) was used for plasmid maintenance Two plasmids pBluescript II KS(+) (Stratagene) and ... strain Iso1 was V paradoxus For example, the stain Isol was positive for catalase, oxidase and nitrate reduction but negative of hydrolysis for gelatin and starch Therefore, according to all above ... DNA (data not shown) At the same time, degenerate primers for the N-DAAase gene were developed using alignment analysis of the other N-D-AAase protein gene sequences in the GenBank database A...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: The gene carD encodes the aldehyde dehydrogenase responsible for neurosporaxanthin biosynthesis in Fusarium fujikuroi potx
... The genes needed for the synthesis of b-carotene and retinal, carRA, carB, and carX, are clustered with one of the rhodopsin genes, carO, in the F fujikuroi genome, whereas the gene needed for ... performed for days in the dark at 22 °C For large-scale DNA preparation, 250-mL Erlenmeyer flasks containing 50 mL of medium were inoculated with 108 conidia and incubated for days at 30 °C before ... carotenoid pathway (Fig 1) To obtain genetic evidence for this function, transformation experiments were carried out to obtain null carD mutants of F fujikuroi by targeted gene replacement with a hygromycin...
Ngày tải lên: 14/03/2014, 22:20
Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx
... the absence of ligand Therefore, this newly identified Kozak sequence could be used in EcR gene switches, as well as other gene switches, for the regulation of transgenes in plants The data presented ... Site-directed mutagenesis was carried out using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) Mutations were verified by sequencing The primers used for mutagenesis were ... plants for controlled regulation of gene expression Mol Gen Genet 261, 546–552 Padidam M, Gore M, Lu DL & Smirnova O (2003) Chemical-inducible, ecdysone receptor-based gene expression system for...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation potx
... of Rep gene products on BeYDV gene expression To determine the respective roles of various BeYDV gene products in the regulation of complementary sense gene expression, we cobombarded Rep gene ... required for both virion and complementary sense gene expression We found that Rep A (C1) acts as a potent transactivator of virion sense gene expression and inhibitor of complementary sense gene ... contains sequences responsible for transcription of genes in both genome senses, as well as an inverted repeat sequence that forms the hair–loop structure required for replication [7] A conserved...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function pptx
... supported by Grants-in-Aid for Scientific Research for the Ministry of Education, Science and Culture of Japan (Nos 15590587 for Dr H Okuda, 15591018 for Dr T Kamesaki and 15590586 for Dr S Iwamoto) References ... ⁄ REF activates RH gene promoter function intron of the RHD and CE genes revealed 3.7 kb bands (solid arrow head in Fig 1) along with weakened 20 kb (CE gene) and 18 kb (D gene) bands Probes ... the RHD gene was inserted into the pGL3 Fig DNaseI hypersensitivity mapping of the RH gene in HEL cells Probes are indicated in the locus map Restriction sites of EcoRV and exons of each gene are...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... product from the endogenous WD gene Amplification conditions were: 95 °C for followed by 18 cycles of 95 °C for 45 s, 55 °C for 45 s, 72 °C for 45 s, and 72 °C for Ó FEBS 2002 2154 W J Oh et al ... was performed at 65 °C for and 37 °C for 60 followed by denaturation at 95 °C in a total volume of 50 lL of reaction mixture using the RT-PCR kit (Stratagene) PCR amplification was performed using ... was performed according to the Current Protocol method [35] Concentrated Ku proteins were digested with 50 lL 70% formic acid at 37 °C for 48 h The peptide fragments generated by the formic acid...
Ngày tải lên: 17/03/2014, 23:20
Gene Transfer Approaches for Gynecological Diseases pot
... adenoviral fiber [41,42], and a trial is forthcoming Antiangiogenic Gene Therapy Antiangiogenic gene transfer inhibits formation of neovasculature required for tumor growth and may also act by collapsing ... proposals for human therapy Hum Gene Ther 11: 1553 – 1567 98 Kay, M A., et al (2000) Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector Nat Genet ... embryo implantation disorder, making it a possible target for gene therapy Homeobox (HOX) genes are transcription factors necessary for embryonic development Unlike in most adult tissues, HOXA10...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot
... Tsuchiya R, Kondo S, Motoyama J & Higashinakagawa T (1995) Gene trap capture of a novel mouse gene, jumonji, required for neural tube formation Genes Dev 9, 1211–1222 Ahmed S, Palermo C, Wan S & Walworth ... was performed at least three times, and representative spreads are shown For immunostaining of whole salivary glands, dissected glands were fixed in 4% formaldehyde ⁄ 0.15% Triton X-100 for 20 ... characterization were performed as previously described [34] Generation of transgenic flies and rescue experiment For constructing the pUAST–FLAG–mjmj vector, a cDNA for FLAG–mjmj in pBluescript...
Ngày tải lên: 23/03/2014, 07:20