Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx

Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site Ajay K Singh1,2, Venkata S Tavva1,2, Glenn B Collins2 and Subba R Palli1 Department of Entomology, University of Kentucky, Lexington, KY, USA Plant and Soil Sciences Department, University of Kentucky, Lexington, KY, USA Keywords ecdysone receptor; gene switch; genetically modified crops; methoxyfenozide; retinoid X receptor Correspondence S R Palli, Department of Entomology, S225 Ag Science N, University of Kentucky, Lexington, KY 40546-0091, USA Fax: +1 859 323 1120 Tel: +1 859 257 4962 E-mail: rpalli@uky.edu (Received May 2010, revised September 2010, accepted September 2010) doi:10.1111/j.1742-4658.2010.07871.x Gene switches have potential applications for the regulation of transgene expression in plants and animals Recently, we have developed a twohybrid ecdysone receptor (EcR) gene switch using chimera [CH9, a chimera between helices 1–8 of Homo sapiens retinoid X receptor (HsRXR) and helices 9–12 of Locusta migratoria RXR (LmRXR)] as a partner for Choristoneura fumiferana EcR (CfEcR) As CH9 includes a region of human RXR, public acceptance of this gene switch for use in genetically modified crops may be an issue The current studies were conducted to identify an LmRXR mutant that could replace CH9 as a partner for CfEcR The amino acid identity between LmRXR and HsRXR is fairly high However, there are a few amino acid residues that are different between these two proteins LmRXR mutants were produced by changing the amino acids in the helices 1–8 that are different between LmRXR and HsRXR to HsRXR residues Screening of these mutants in tobacco protoplasts identified a triple mutant, A62S:T81H:V123I (SHILmRXR), that performed as well as CH9 The performance of the EcR gene switch was further improved by optimizing the translational start site (Kozak sequence, AACAATGG) of the transgene The EcR gene switch containing SHILmRXR and the modified translation start site supported very low background activity in the absence of a ligand and a higher induced activity in the presence of a ligand in tobacco protoplasts, as well as Arabidopsis thaliana transgenic plants At 16–80 nm methoxyfenozide, the induction of luciferase activity was better than that observed with the CfEcR:CH9 switch Introduction The conditional regulation of transgene expression by the interaction of a chemical inducer with a designed receptor or transcription factor is a powerful tool for the regulation of transgenes in genetically modified crops, as well as for plant biotechnological applications [1–4] Several chemically inducible gene Abbreviations AD, activation domain; CfEcR, Choristoneura fumiferana ecdysone receptor; CH9, chimera 9; DBD, DNA-binding domain; EcR, ecdysone receptor; FMV, figwort mosaic virus; HsRXR, Homo sapiens retinoid X receptor; LBD, ligand-binding domain; LmRXR, Locusta migratoria retinoid X receptor; MMV, Mirabilis mosaic virus 4640 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS A K Singh et al regulation systems or gene switches that respond to a variety of chemicals have been developed [1,4–15] Most of the gene switches developed to date use compounds that are not suitable for large-scale applications in the field because of environmental concerns To overcome these problems, a more versatile chemically inducible gene regulation system has been developed [3,4,16] The ecdysone receptor (EcR)-based gene regulation system is one of the best gene switches available, because the chemical ligands required for its regulation, tubufenozide and methoxyfenozide, are already registered for field use [17,18] The advantages and limitations associated with various chemically inducible gene switches that have been developed to date have been discussed in recent reviews [4,18–20] A chemically inducible gene regulation system that specifically regulates transgene expression in response to an exogenous inducer at a particular stage of plant development, or in a specific organ, is valuable for the expression of transgenes whose constitutive overexpression is likely to compromise plant viability or fertility In addition, gene switches are useful to reduce environmental concerns, such as gene pollution and antibiotic resistance development, associated with genetically modified crops [17,18,21] The properties of an ideal chemically inducible gene regulation system vary with each application; in general, the gene switch should show an undetectable level of transgene expression in the absence of a chemical ligand, followed by rapid and robust induction of transgene expression in the presence of a low concentration (nanomolar) of a chemical ligand In an effort to find an ideal chemically inducible gene regulation system, several approaches have been tried [1,10,14,22– 25] An EcR gene switch with a potential for use in large-scale field applications and applicability to a variety of plant species has been developed by adopting a two-hybrid format [26] This two-hybrid gene switch uses chimera [CH9, a chimera between helices 1–8 of Homo sapiens retinoid X receptor (HsRXR) and helices 9–12 of Locusta migratoria RXR (LmRXR)] as a partner of Choristoneura fumiferana ecdysone receptor (CfEcR), and shows low background activity in the absence of ligand and high induction of luciferase reporter gene in the presence of nanomolar concentrations of methoxyfenozide ligand [27] In a two-hybrid switch format, the GAL4 DNA-binding domain (GAL4 DBD) is fused to the ligand-binding domain (LBD) of CfEcR, and the VP16 activation domain (VP16 AD) is fused to LBD of LmRXR On application of methoxyfenozide, the heterodimer of these two fusion proteins transactivates the luciferase reporter gene placed under the control of Improvement of ecdysone receptor gene switch multiple copies of GAL4 response elements and the )46 35S minimal promoter (that includes )46 to the TATAA box of the 35S promoter [27]) To develop an EcR gene switch that is highly sensitive and exhibits low background activity in the absence of ligand, we compared the amino acid residues in helices 1–8 of LmRXR and HsRXR Based on the amino acid sequence differences in helices 1–8 of LmRXR and HsRXR, several LmRXR mutants were created by employing the site-directed mutagenesis method We identified a triple mutant of LmRXR, SHILmRXR, which is as efficient as CH9 as a partner of CfEcR The performance of the EcR gene switch with the SHILmRXR mutant was compared with that of the gene switches containing wild-type LmRXR and CH9, as a partner of CfEcR, in inducing reporter gene expression in tobacco protoplasts The results observed in protoplasts were confirmed in Arabidopsis transgenic plants To further improve the performance of the EcR gene switch containing the SHILmRXR mutant as a partner of CfEcR, Kozak sequences were incorporated upstream of the coding sequence of the reporter gene and compared with the standard reporter construct A Kozak sequence was identified that worked well in combination with the CfEcR gene switch Results Transient expression studies with tobacco protoplasts RXR mutagenesis The amino acid identity between LmRXR and HsRXR is fairly high However, there are a few amino acid residues that are different between these two proteins Site-directed mutagenesis was carried out to change the amino acid residues that were different between LmRXR and HsRXR in helices 1–8 to HsRXR residues in LmRXR (Fig 1A, B) The performance of the LmRXR mutants in inducing luciferase reporter gene activity in a two-hybrid format was tested by co-electroporation of CfEcR and LmRXR and the luciferase reporter constructs into tobacco protoplasts Among the LmRXR mutants screened, the T81H mutant showed low background activity in the absence of ligand, and the A62S mutant showed high induction of luciferase in the presence of ligand, when compared with wild-type LmRXR (Fig 2A) In order to combine the desirable properties of these two LmRXR mutants, we incorporated these two mutations together The A62S:T81H mutant (SHLmRXR) showed low background activity in the absence of ligand when compared with wild-type LmRXR, but FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4641 Improvement of ecdysone receptor gene switch A A K Singh et al 35S P DBD EcR T 35S P AD RXR T GAL4 RE TATA Reporter gene T Methoxyfenozide (M) M DBD EcR RXR Basic transcriptional machinery AD TATA Reporter gene T GAL4 RE B Fig (A) Schematic diagram of EcR two-hybrid switch CfEcR plasmid was constructed by cloning a fusion of the GAL4 DBD (DBD) and CfEcR LBD (EcR LBD) cloned under the control of the 35S promoter (35SP) in the pKYLX80 vector [29] containing the terminator sequence (T) LmRXR plasmid was constructed by cloning the fusion of the VP16 activation domain (AD) and LmRXR LBD (RXR LBD) under the control of the 35S promoter in the pKYLX80 vector The reporter vector )4635SLuc was constructed by cloning the luciferase reporter under the control of 5· GAL4 response elements and a 35S minimal promoter containing )46 to the TATAA box [27] The ligand used in this switch is the ecdysone agonist, methoxyfenozide (M) (B) The alignment of the amino acid sequences of HsRXR and LmRXR helices 1–8 The amino acids that are identical between HsRXR and LmRXR are marked with a shaded background Five amino acids selected for the first round of site-directed mutagenesis are boxed Arrowheads point to the two amino acids tested as triple mutants lower induced luciferase activity With a goal to improve the induction levels of the reporter gene in the presence of ligand, we introduced two additional mutations (V68I and V123I) into A62S:T81H LmRXR Screening of these mutants identified a triple mutant, A62S:T81H:V123I (SHILmRXR), that showed low background activity in the absence of ligand and high induced activity in the presence of ligand when compared with the levels observed in either wild-type LmRXR or the double mutant SHLmRXR (Fig 2B) Optimization of translational start site Several Kozak sequences placed upstream of the luciferase reporter gene translational start site were screened to determine whether they improved the transgene expression in plants Among several Kozak sequences tested, AACAATGG performed the best in enhancing the induction of luciferase activity (Fig 3) When this Kozak sequence was placed upstream of the luciferase reporter gene, the induction of luciferase 4642 increased significantly when compared with the induction of luciferase supported by the start site present in the commercial reporter vector (Promega Corporation, Madison, WI, USA) Comparison of performance of CfEcR:SHILmRXR, CfEcR:CH9 and CfEcR:LmRXR gene switches in tobacco protoplasts We compared the performance of CfEcR:SHILmRXR, CfEcR:CH9 and CfEcR:LmRXR gene switches in combination with the newly identified Kozak sequence by transfection of receptor and luciferase reporter constructs into tobacco protoplasts The transfected protoplasts were exposed to various concentrations of methoxyfenozide and the luciferase activity was quantified As shown in Fig 4, both SHILmRXR and CH9 showed very low background activity in the absence of ligand when compared with the background activity exhibited by the LmRXR wild-type receptor The reporter gene placed under the control of the EcR gene FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS A K Singh et al Improvement of ecdysone receptor gene switch 700 600 500 400 300 200 100 0.64 3.2 16 80 400 Methoxyfenozide (nM) 3.2 16 80 400 Methoxyfenozide (nM) 2000 10 000 B 900 800 700 Luciferase activity (RLU/µg protein) LmRXR Wt SHLmRXR SHILmRXR 600 500 400 300 200 100 0 600 Fig Improvement of Kozak sequence for the expression of transgenes regulated by the EcR gene switch CfEcR, LmRXR and reporter constructs containing three modified versions of Kozak sequences were electroporated into protoplasts The transfected protoplasts were exposed to various concentrations of methoxyfenozide Luciferase activity was measured 24 h after the addition of methoxyfenozide The luciferase values are expressed as relative light units (RLU) per microgram of protein The data shown are the average of three replicates ± standard deviation LmRXR S122A LmRXR A105S LmRXR T94A LmRXR T81H LmRXR A62S LmRXR Wt Luciferase activity (RLU/µg protein) Fig (A) Screening of LmRXR mutants S122A, A105S, T94A, T81H and A62S in tobacco protoplasts Tobacco protoplasts were electroporated with receptor and the reporter constructs Electroporated protoplasts were exposed to various concentrations of methoxyfenozide The luciferase activity was measured 24 h after the addition of methoxyfenozide The luciferase values are expressed as relative light units (RLU) per microgram of protein The data shown are the average of three replicates ± standard deviation (B) Comparison of performance of LmRXR, LmRXR double mutant A62S:T81H (SHLmRXR) and LmRXR triple mutant A62S:T81H:V123I (SHILmRXR) as a partner of CfEcR The receptor and reporter constructs were electroporated into protoplasts The transfected protoplasts were exposed to various concentrations of methoxyfenozide Luciferase activity was measured 24 h after the addition of methoxyfenozide The luciferase values are expressed as RLU per microgram of protein The data shown are the average of three replicates ± standard deviation Luciferase activity (RLU/µg protein) A 0.64 2000 10 000 CfEcR:LmRXR:–46 35S Luc 500 CfEcR:LmRXR:–46 35S Kozak(AAAAATGGA) Luc 400 CfEcR:LmRXR:–46 35S Kozak(AACCATGGA) Luc 300 CfEcR:LmRXR:–46 35S Kozak(AACAATGGA) Luc 200 100 0 with either SHILmRXR, CH9 or LmRXR as a partner increased after the protoplasts were exposed to as low as 0.64 nm methoxyfenozide The reporter activity increased steadily as the dose of methoxyfenozide increased, and reached maximum levels in protoplasts exposed to 80 nm methoxyfenozide At this concentra- 0.64 3.2 16 80 400 Methoxyfenozide (nM) 2000 10 000 tion of ligand, the CfEcR:SHILmRXR switch supported the highest induction of reporter activity The CfEcR:CH9 switch supported a reporter activity that was lower than that observed for the CfEcR:SHILmRXR switch, but higher than that observed for the CfEcR:LmRXR switch These transient expression FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4643 Improvement of ecdysone receptor gene switch A 1600 SHILmRXR A K Singh et al CH9 LmRXR Luciferase activity (RLU/µg protein) 1400 1200 1000 800 600 400 200 DMSO 0.64 3.2 16 80 400 2000 10 000 Methoxyfenozide (nM) Luciferase activity (RLU/µg protein) B 1000 900 800 700 600 500 400 300 200 100 0 12 Hours exposed to methoxyfenozide 24 12 24 36 42 Hours after methoxyfenozide withdrawal Fig (A) Comparison of performance of LmRXR, CH9 and LmRXR triple mutant A62S:T81H:V123I (SHILmRXR) as a partner of CfEcR The receptor and reporter constructs were electroporated into protoplasts The transfected protoplasts were exposed to various concentrations of methoxyfenozide Luciferase activity was measured 24 h after the addition of methoxyfenozide The luciferase values are expressed as relative light units (RLU) per microgram of protein The data shown are the average of three replicates ± standard deviation DMSO, dimethylsulfoxide (B) Time course of ‘turn on’ and ‘turn off’ of CfEcR:SHILmRXR switch The receptor and reporter constructs were electroporated into protoplasts The transfected protoplasts were exposed to 80 nM methoxyfenozide for 0, 3, 6, 12 and 24 h The protoplasts were collected at the end of each time point and the luciferase activity was measured; the values are expressed as RLU per microgram of protein In ligand withdrawal experiments, the transfected protoplasts were exposed to 80 nM methoxyfenozide for 24 h, followed by incubation in ligand-free medium for 6, 12, 24, 36 and 42 h The protoplasts were collected at the end of each time point and the luciferase activity was measured The data shown are the average of three replicates ± standard deviation studies in tobacco protoplasts showed that SHILmRXR was an excellent partner for CfEcR because of low background activity in the absence of ligand and higher induced activity in the presence of ligand, the two most desirable properties of a successful gene switch A time-course experiment was conducted to determine the ‘on’ and ‘off’ properties of the CfEcR:SHILmRXR gene switch The luciferase gene expression regulated by CfEcR:SHILmRXR began to increase at h after addition of the ligand, and reached maximum levels 24 h after the addition of the ligand (Fig 4B) The luciferase activity began to decrease 24 h after withdrawal of the ligand, and showed a continuous decrease until 42 h after ligand withdrawal By this time, about 75% of the induced luciferase activity had disappeared (Fig 4B) The 4644 performances of CfEcR:SHILmRXR, CfEcR:CH9 and CfEcR:LmRXR switches were further compared in transgenic plants as described in the next section Comparison of performance of CfEcR:SHILmRXR, CfEcR:CH9 and CfEcR:LmRXR gene switches in Arabidopsis transgenic plants For stable transformation, CfEcR:SHILmRXR, CfEcR:CH9 and CfEcR:LmRXR gene switches and the luciferase reporter constructs were cloned into the T-DNA region of the pCAMBIA2300 binary vector The Arabidopsis transgenic plants were developed and evaluated for their dose–response and time course of induction of luciferase activity in the presence of methoxyfenozide FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS A K Singh et al Improvement of ecdysone receptor gene switch oxyfenozide dose–response to that observed in plants containing the CfEcR:SHILmRXR switch (Fig 5) Dose–response study with T2 Arabidopsis plants In order to analyze the dose–response of methoxyfenozide, four Arabidopsis lines were selected for each construct The T2 seeds were germinated on agar medium supplemented with 50 mgỈL)1 kanamycin and (dimethylsulfoxide), 0.64, 3.2, 16, 80, 400, 2000 and 10 000 nm methoxyfenozide After 20 days, three seedlings from each plate were collected and assayed separately for luciferase activity The plants containing the CfEcR:SHILmRXR switch exhibited low background activity of luciferase in the absence of ligand On application of 16–80 nm methoxyfenozide, the luciferase activity in the CfEcR:SHILmRXR plants increased in a dose-dependent manner (Fig 5) The induction of the luciferase reporter supported by this switch was initiated at a concentration as low as 0.64 nm methoxyfenozide and reached maximum levels at 16–80 nm methoxyfenozide The methoxyfenozide dose–response of the CfEcR:SHILmRXR switch in combination with the new Kozak sequence was similar to the dose–response described above for the CfEcR:SHILmRXR switch and the original Kozak sequence However, the luciferase activity at each dose of methoxyfenozide was higher in plants containing the new Kozak sequence The transgenic plants containing the CfEcR:LmRXR switch showed higher background luciferase activity in the absence of ligand and lower induced luciferase activity in the presence of ligand The transgenic plants containing the CfEcR:LmRXR switch showed a similar meth- Time course studies in Arabidopsis plants In order to evaluate the time course of the methoxyfenozide response by the three EcR gene switches, T2 seeds collected from Arabidopsis transgenic lines were germinated on agar medium containing 50 mgỈL)1 kanamycin without methoxyfenozide After 20 days, the seedlings were transferred to the glasshouse and different concentrations of methoxyfenozide ligand were applied to soil The luciferase reporter gene expression was quantified at 0, 1, and days after application of methoxyfenozide As shown in Fig 6, luciferase activity began to increase 24 h after application of the ligand to the soil, and continued to increase up to days At most of the time points tested, the luciferase induction values observed were higher in seedlings exposed to 16–80 nm methoxyfenozide (Fig 6A) The time course of activity of methoxyfenozide was similar for all three gene switches tested Time course studies were also conducted using T3 Arabidopsis transgenic plants expressing CfEcR and SHILmRXR to determine the ‘on’ and ‘off’ properties of this gene switch As shown in Fig 6B, luciferase activity began to increase h after the addition of ligand, and reached maximum levels by 96 h after application of the ligand The luciferase activity began to decrease 48 h after withdrawal of the ligand, and 700 Luciferase activity (RLU/µg protein) LmRXR 600 SHILmRXR CH9 500 400 300 200 100 0 0.64 3.2 16 80 400 Methoxyfenozide (nM) 2000 10 000 Fig Comparison of performance of LmRXR, CH9 and LmRXR triple mutant T81H:A62S:V123 (SHILmRXR) as a partner of CfEcR in T2 Arabidopsis plants Seeds collected from T1 Arabidopsis lines were plated on agar medium containing 50 mgỈL)1 kanamycin and different concentrations (0, 0.64, 3.2, 16, 80, 400, 2000, 10 000 nM) of methoxyfenozide Three seedlings from each plate were collected separately and ground in a volume of 100 lL of 1· passive lysis buffer, and the luciferase activity was measured and expressed in terms of relative light units (RLU) per microgram of protein Data shown are the average of three replicates ± standard deviation FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4645 Improvement of ecdysone receptor gene switch A K Singh et al Luciferase activity (RLU/µg protein) A 700 day 600 day 500 day day 400 300 200 100 SHILmRXR LmRXR CH9 Luciferase activity (RLU/µg protein) B 600 500 400 300 200 100 0 12 24 96 Hours exposed to methoxyfenozide 24 48 72 96 120 144 Hours after methoxyfenozide withdrawal Fig (A) Comparison of performance of LmRXR, CH9 and LmRXR triple mutant A62S:T81H:V123I (SHILmRXR) as a partner of CfEcR in T2 Arabidopsis plants growing in soil Seedlings grown on agar medium without added methoxyfenozide were transferred to the glasshouse; 80 nM methoxyfenozide was applied to the soil Three leaf disks were collected at 0, 1, and days after the addition of ligand, and the luciferase activity was measured and expressed in terms of relative light units (RLU) per microgram of protein Data shown are the average of three replicates ± standard deviation (B) Time course of ‘turn on’ and ‘turn off’ of CfEcR:SHILmRXR switch in transgenic plants Seedlings grown on agar medium without added methoxyfenozide were transferred to the glasshouse; 80 nM methoxyfenozide was applied to the soil Three leaf disks were collected at 0, 6, 12, 24 and 96 h after the addition of ligand, and the luciferase activity was measured and expressed in terms of RLU per microgram of protein In ligand withdrawal experiments, transgenic plants grown in soil containing 80 nM methoxyfenozide for 96 h were transferred to ligand-free soil, and samples were collected at 24, 48, 72, 96, 120 and 144 h after transfer The luciferase activity was measured in leaf disks collected at each time point The data shown are the average of four replicates ± standard deviation reached less than 25% of the induced levels by 144 h after withdrawal of the ligand Discussion The major contribution of this study was the identification of the SHILmRXR mutant, which performs better than CH9 as a partner for CfEcR for application as a chemically inducible gene regulation system in plants The CfEcR:SHILmRXR switch showed a low background activity of the reporter gene in the absence of ligand and a high induced activity of the luciferase gene in the presence of a concentration as low as 16 nm methoxyfenozide Several versions of EcR gene switches have been developed for use in plants [3,4,13,16] The EcR gene switch developed by Tavva et al [26] uses CH9 as a partner of CfEcR As 4646 CH9 is a region of HsRXR, this may not be accepted by the public for applications in genetically modified crops Therefore, the current study was conducted to find an alternative partner for CfEcR Previous studies on comparisons between EcR:HsRXR and EcR:LmRXR gene switches have shown that the EcR:HsRXR switch exhibits a low background activity of the reporter in the absence of ligand, but the ligand sensitivity of this switch is lower than that of the EcR:LmRXR gene switch [27] In contrast, the EcR:LmRXR switch shows higher ligand sensitivity when compared with the EcR:HsRXR switch, but this switch shows higher background activity of the reporter gene in the absence of ligand We hypothesized that the differences in ligand sensitivity and background expression levels of luciferase reporter gene activity between LmRXR and HsRXR containing EcR gene switches FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS A K Singh et al might be a result of differences in the amino acid sequences in helices 9–11, because CH9, which was created by fusing helices 1–8 of HsRXR LBD and helices 9–12 of LmRXR LBD, performed very well by showing the desirable properties of both EcR:HsRXR and EcR:LmRXR switches To test this hypothesis, seven LmRXR mutants were created and tested by transfection of the LmRXR mutants, together with CfEcR and reporter constructs, into tobacco protoplasts These screening assays identified a triple mutant of LmRXR, SHILmRXR, that showed low background activity in the absence of ligand when used as a partner of CfEcR The activity of this triple mutant of LmRXR was different from that of wild-type LmRXR in this respect, as wild-type LmRXR as a partner of EcR showed high background activity in the absence of ligand In addition, the CfEcR:SHILmRXR gene switch also supported a high induced activity of reporter gene in the presence of a ligand concentration as low as 16 nm methoxyfenozide This induced activity supported by SHILmRXR as a partner of CfEcR was better than that observed when wild-type LmRXR was used as a partner of CfEcR Thus, this newly identified triple mutant of LmRXR as a partner of CfEcR possesses two of the most desirable properties of receptors used in gene switches Comparative studies in tobacco protoplasts, as well as in Arabidopsis transgenic plants, showed that the background activity of the CfEcR:SHILmRXR switch was similar to that supported by the CfEcR:CH9 switch, but the induced reporter activity supported by the CfEcR:SHILmRXR switch in the presence of 16–80 nm methoxyfenozide was better than that observed for the CfEcR:CH9 switch The differences observed in the background activity in the absence of ligand and induced reporter activity in the presence of ligand between wild-type LmRXR and its triple mutant are most probably caused by differences in their ability to heterodimerize with CfEcR [17,18] Previous studies in mammalian cells on the heterodimerization of EcR and RXR have suggested that SHILmRXR does not heterodimerize with EcR in the absence of ligand [28] This mutant behaves like HsRXR in this respect Palli et al [28] reported that HsRXR does not heterodimerize with CfEcR in the absence of ligand In the presence of a nanomolar concentration of methoxyfenozide, SHILmRXR heterodimerizes well with CfEcR and transactivates genes placed under the control of methoxyfenozide response promoters In this respect, SHILmRXR behaves like CH9 Palli et al [18] showed that, when compared with either HsRXR or LmRXR, the chimeras between HsRXR and LmRXR heterodimerize well with CfEcR at nanomolar concentrations of ecdysteroid ligands Improvement of ecdysone receptor gene switch We screened several Kozak sequences to identify a sequence that supports better transgene expression in plants We observed a significant increase in luciferase reporter gene activity in the presence of ligand when a Kozak sequence containing AACAATGG was used to replace the native luciferase reporter gene Kozak sequence Interestingly, an increase in the ligandinduced activity of this switch containing the improved Kozak sequence was not accompanied by an increase in background activity in the absence of ligand Therefore, this newly identified Kozak sequence could be used in EcR gene switches, as well as other gene switches, for the regulation of transgenes in plants The data presented here clearly demonstrate that luciferase reporter gene expression is tightly regulated by the CfEcR:SHILmRXR gene switch This gene switch showed negligible levels of background reporter gene activity in the absence of ligand and the highest levels of induced reporter gene activity in the presence of a concentration as low as 16 nm of methoxyfenozide Although the amino acid identity between SHILmRXR and HsRXR was increased, when compared with the amino acid identity between wild-type receptors, SHILmRXR performed much better than wild-type LmRXR as a partner for EcR, and SHILmRXR is an insect receptor Therefore, the improvement made to the EcR gene switch in this study by the manipulation of LmRXR as a partner of CfEcR may lead to the widespread use of this gene switch for applications in plants Experimental procedures Ligand Technical grade (99% pure) methoxyfenozide (a gift from Rohm and Haas Company, Spring House, PA, USA) was dissolved in dimethylsulfoxide to prepare 100 mm solution Various dilutions of this ligand in dimethylsulfoxide were prepared from this stock solution LmRXR mutants Site-directed mutagenesis was carried out using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) Mutations were verified by sequencing The primers used for mutagenesis were as follows: LmS122A (F), CTTGGCTGCTTGCGAGCTGTTATTCT TTTCAATCC; LmS122A (R), GGATTGAAAAGAATAA CAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACA GAACTGGTATCAAAGATGAGAGAAATG; LmA105S (R), CATTTCTCTCATCTTTGATACCAGTTCTGTCAA; LmT94A (F), CAAGCTGGAGTCGGCGCAATATTTGA CAGAGTTTTG; LmT94A (R), CAAAACTCTGTCAAA FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4647 Improvement of ecdysone receptor gene switch A K Singh et al TATTGCGCCGACTCCAGCTTG; LmT81H (F), CTTGC CACTGGTCTCCACGTGCATCGAAATTCTGCC; LmT81H (R), GGCAGAATTTCGATGCACGTGGAGACCAGTG GCAA; Lm A62S (F), GAACTGCTAATTGCATCATTT TCACATCGATCTG; Lm A62S (R), CAGATCGATGTG AAAATGATGCAATTAGCAGTTC; Lm V123I (F), TGG CTGCTTGCGATCTATTATTCTTTTCAATCC; Lm V123I (R), GGATTGAAAAGAATAGATCGCAAGCAGCCA Screening of LmRXR mutants in tobacco protoplasts The LmRXR mutants S122A, A105S, T94A, T81H, A62S, A62S:T81H and A62S:T81H:V123I were cloned downstream of the VP16 AD sequence in the pVP16 vector (BD Biosciences Clonetech, San Jose, CA, USA) DNA sequences coding for the fusion protein of VP16 AD and LmRXR mutants were transferred from pVP16LmRXR to the pKYLX80 vector [29] using NheI and XbaI restriction endonucleases GAL4 and CfEcRDEF fusion protein construct (CfEcR) and a reporter construct containing the gene coding for luciferase under the control of the )46 35S minimal promoter and GAL4 response elements ()4635SLuc) were cloned into the pKYLX80 vector (Table 1) Transient expression studies were carried out by isolating protoplasts from cell suspension cultures of tobacco (Nicotiana tabacum cv Xanthi-Brad) A detailed description of the isolation and electroporation of protoplasts has been given previously by Tavva et al [26] Dose–response and time course studies in tobacco protoplasts The methoxyfenozide dose-dependent performance of different LmRXR mutants in inducing luciferase reporter gene activity in a two-hybrid gene switch was tested by co-electroporation of pK80-46 35S:luc, pK80GCfE and mutant LmRXR constructs The electroporated protoplasts were incubated in growth medium containing 0, 0.64, 3.2, 16, 80, 400, 2000 and 10 000 nm methoxyfenozide Twenty-four hours after the addition of ligand, the protoplasts were assayed for luciferase reporter gene activity using a Fluoroscan FL plate reader (Fluoroscan Ascent FL, Thermo Biosystems, Milford, MA, USA) as described previously [26] In time course experiments, the protoplasts transfected with CfEcR and SHILmRXR and the )46 35SLuc reporter were exposed to 80 nm methoxyfenozide for 0–24 h, protoplasts were collected and the luciferase activity was measured In ligand withdrawal experiments, the transfected protoplasts were exposed to 80 nm methoxyfenozide for 24 h, and the protoplasts were then transferred to ligand-free medium and incubated for an additional 6–42 h The protoplasts were collected at the end of each time point and the luciferase activity was measured 4648 Optimization of translational start site using Kozak sequences Kozak sequences (AAAAATGG, AACCATGG and AACAATGG) were placed upstream of the luciferase reporter gene and screened for transgene expression in plants )46 and )31 35S minimal promoters were cloned into the pKYLX80 vector as described by Tavva et al [26] The luciferase reporter gene was PCR amplified from the pFRLuc vector (Stratagene) using several sets of primers containing different Kozak sequences, and cloned into pGEM-T Easy vector to verify the integration of the Kozak sequences The PCR primers used were as follows: KZKLUC2 (F), CTCGAGAAAAATGGAAGACGCCAAAAAC ATAAAG; KZKLUC4 (F), CTCGAGAACCATGGAAGA CGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAA CAATGGAAGACGCCAAAAACATAAAG The bold letters in the primers show Kozak sequence The luciferase reporter gene with the Kozak sequence was then excised from the pGEM-T Easy vector and cloned into the XhoI ⁄ SacI sites downstream of the )46 35S minimal promoter in the modified pKYLX80 vector The reporter gene expression cassette with the pKYLX80 background was designated as pK80-46 35S:KLuc The full-length luciferase gene was cloned into the pKYLX80 vector under the control of the cauliflower mosaic virus (CaMV) 35S promoter and used as a positive control in transient transfection studies Binary vectors for stable transformation of Arabidopsis Binary vectors for stable transformation of Arabidopsis thaliana were constructed in pCAMBIA2300 vectors (CAMBIA, Canberra, Australia) To construct the binary vector for plant transformation, the GAL4DBD:CfEcRDEF fusion gene was cloned under the control of the figwort mosaic virus (FMV) promoter and ubiquitin (Ubi) terminator sequence, and the VP16AD:LmRXR fusion gene was cloned under the control of the Mirabilis mosaic virus (MMV) promoter and Agrobacterium tumefaciens octopine synthase (Ocs) poly A sequence The FMV- and MMV-driven expression cassettes were assembled into the pSL301 vector The reporter and receptor expression cassettes were excised with appropriate restriction enzymes and assembled into the pCAMBIA2300 vector for plant transformation The map of the binary vector used is shown in Fig Production of transgenic plants Arabidopsis thaliana (L.) Heynth ecotype Columbia ER was used for plant transformation experiments The binary vectors were mobilized into Agrobacterium tumefaciens strain GV3850 by the freeze–thaw method Arabidopsis plants were transformed using the whole-plant dip method [30] Trans- FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS A K Singh et al UbiT Improvement of ecdysone receptor gene switch CfEcR GAL4 DBD SpeI/XbaI FMVP rbcST Kozak-Luc –46 35S P GAL4 RE SalI MMV P VP16 AD LmRXR mutant PstI OCS T HindIII Fig p2300:Lm7:KLuc: T-DNA region of the pCAMBIA2300 binary vector showing the assembly of receptor and reporter expression cassettes FMVP, figwort mosaic virus promoter; MMVP, Mirabilis mosaic virus promoter; OCST, Agrobacterium tumefaciens octopine synthase poly A; rbcST, poly A sequence; UbiT, ubiquitin terminator; 35S P, CaMV 35S promoter with double enhancer sequence Table Constructs used in the experiments Name of the construct CfEcR LmRXR CH9 SHLmRXR SHILmRXR )46 35SLuc )46 35SLuc Description A fusion of GAL4 DNA-binding domain with CfEcR ligand-binding domain cloned under the control of the 35S promoter in the pKYLX80 vector A fusion of VP16 activation domain and LmRXR ligand-binding domain cloned under the control of the 35S promoter in the pKYLX80 vector Chimera 9, a chimera between helices 1–8 of Homo sapiens retinoid X receptor (HsRXR) and helices 9–12 of Locusta migratoria retinoid X receptor (LmRXR) A double mutant A62S:T81H of LmRXR A triple mutant A62S:T81H:V123I of LmRXR Luciferase regulated by 5· GAL4 response elements and )46 to TATAA 35S promoter Luciferase containing modified Kozak sequence and regulated by 5· GAL4 response elements and )46 to TATAA 35S promoter genic Arabidopsis plants were selected by germinating the seeds collected from the infiltrated plants on medium containing 50 mgỈL)1 kanamycin The analysis of transgenic plants for luciferase induction level was carried out on T2 and T3 seeds plated on kanamycin-containing medium Dose–response studies in T2 Arabidopsis plants Seeds collected from four T1 Arabidopsis lines were plated on agar medium containing 50 mgỈL)1 kanamycin and different concentrations of methoxyfenozide (0, 0.64, 3.2, 16, 80, 400, 2000, 10 000 nm) The seeds were allowed to germinate and were grown on the induced medium for 20 days at 25 °C, 16 h light ⁄ h dark Three seedlings from each plate were collected separately and ground in a volume of 100 lL of 1· passive lysis buffer (Promega Corporation), and the luciferase activity was measured To study the dose–response in soil-grown plants, T2 Arabidopsis plants were transferred to soil in pots placed in a glasshouse, and the plants were allowed to grow in the glasshouse until they had developed a complete whorl of rosette leaves Different doses of methoxyfenozide (0, 0.64, 3.2, 16, 80, 400, 2000, 10 000 nm) were applied to the pots three times at 2-day intervals Leaf disks were collected on day and the luciferase activity was measured Time course studies in soil-grown plants T2 Arabidopsis plants were transferred to a glasshouse, and a time course study was conducted after application of 0, 0.64, 3.2, 16, 80, 400, 2000 or 10 000 nm methoxyfenozide to the soil Care was taken not to leach out any excess solution Leaf disks were collected at 0, 1, and days after application of methoxyfenozide, and the luciferase activity was measured To determine the ‘on’ and ‘off’ properties of the CfEcR:SHILmRXR switch, time course studies were conducted using T3 Arabidopsis plants The transgenic T3 Arabidopsis plants growing in the soil were exposed to 80 nm methoxyfenozide for 0–96 h The luciferase activity was determined in leaf disks collected at 0, 6, 12, 24 and 96 h after application of the ligand For ligand withdrawal experiments, T3 Arabidopsis plants were exposed to 80 nm methoxyfenozide for 96 h, followed by transfer to ligandfree soil The luciferase activity was determined in leaf disks collected at 24, 48, 72, 96, 120 and 144 h after withdrawal of the ligand Acknowledgements This work was supported by Consortium for Plant Biotechnology Research This is contribution number 10-08-112 from the Kentucky Agricultural Experimental Station References Aoyama T & Chua NH (1997) A glucocorticoidmediated transcriptional induction system in transgenic plants Plant J 11, 605–612 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS 4649 Improvement of ecdysone receptor gene switch A K Singh et al Koo JC, Asurmendi S, Bick J, Woodford-Thomas T & Beachy RN (2004) Ecdysone agonist-inducible expression of a coat protein gene from tobacco mosaic virus confers viral resistance in transgenic Arabidopsis Plant J 37, 439–448 Martinez A, Sparks C, Drayton P, Thompson J, Greenland A & Jepson I (1999a) Creation of ecdysone receptor chimeras in plants for controlled regulation of gene expression Mol Gen Genet 261, 546–552 Padidam M, Gore M, Lu DL & Smirnova O (2003) Chemical-inducible, ecdysone receptor-based gene expression system for plants Transgenic Res 12, 101–109 Gatz C, Frohberg C & Wendenburg R (1992) Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants Plant J 2, 397–404 Wilde RJ, Shufflebottom D, Cooke S, Jasinska I, Merryweather A, Beri R, Brammar WJ, Bevan M & Schuch W (1992) Control of gene expression in tobacco cells using a bacterial operator-repressor system EMBO J 11, 1251–1259 Williams S, Friedrich L, Dincher S, Carozzi N & Kessmann H (1992) Chemical regulation of Bacillus thuringiensis-endotoxin expression in transgenic plants BioTechnol 10, 540–543 Mett VL, Lochhead LP & Reynolds PH (1993) Coppercontrollable gene expression system for whole plants Proc Natl Acad Sci USA 90, 4567–4571 Rieping M, Fritz M, Prat S & Gatz C (1994) A dominant negative mutant of PG13 suppresses transcription from a cauliflower mosaic virus 35S truncated promoter in transgenic tobacco plants Plant Cell 6, 1087–1098 10 Weinmann P, Gossen M, Hillen W, Bujard H & Gatz C (1994) A chimeric transactivator allows tetracyclineresponsive gene expression in whole plants Plant J 5, 559–569 11 Caddick MX, Greenland AJ, Jepson I, Krause KP, Qu N, Riddell KV, Salter MG, Schuch W, Sonnewald U & Tomsett AB (1998) An ethanol inducible gene switch for plants used to manipulate carbon metabolism Nat Biotechnol 16, 177–180 12 Bohner S, Lenk II, Rieping M, Herold M & Gatz C (1999) Technical advance: transcriptional activator TGV mediates dexamethasone-inducible and tetracycline-inactivatable gene expression Plant J 19, 87–95 13 Martinez A, Sparks C, Hart CA, Thompson J & Jepson I (1999b) Ecdysone agonist inducible transcription in transgenic tobacco plants Plant J 19, 97–106 14 Bruce W, Folkerts O, Garnaat C, Crasta O, Roth B & Bowen B (2000) Expression profiling of the maize flavonoid pathway genes controlled by estradiol-inducible transcription factors CRC and P Plant Cell 12, 65–80 15 Zuo J, Niu QW, Moller SG & Chua NH (2001) Chemical-regulated, site-specific DNA excision in transgenic plants Nat Biotechnol 19, 157–161 4650 16 Unger E, Cigan AM, Trimnell M, Xu RJ, Kendall T, Roth B & Albertsen M (2002) A chimeric ecdysone receptor facilitates methoxyfenozide-dependent restoration of male fertility in ms45 maize Transgenic Res 11, 455–465 17 Palli SR, Hormann RE, Schlattner U & Lezzi M (2005a) Ecdysteroid receptors and their applications in agriculture and medicine Vitam Horm 73, 59–100 18 Palli SR, Kapitskaya MZ & Potter DW (2005b) The influence of heterodimer partner ultraspiracle ⁄ retinoid X receptor on the function of ecdysone receptor Febs J 272, 5979–5990 19 Tang W & Newton RJ (2004) Regulated gene expression by glucocorticoids in cultured Virginia pine (Pinus virginiana Mill.) cells J Exp Bot 55, 1499–1508 20 Zuo J & Chua NH (2000) Chemical-inducible systems for regulated expression of plant genes Curr Opin Biotechnol 11, 146–151 21 Hare PD & Chua NH (2002) Excision of selectable marker genes from transgenic plants Nat Biotechnol 20, 575–580 22 Ainley WM & Key JL (1990) Development of a heat shock inducible expression cassette for plants: characterization of parameters for its use in transient expression assays Plant Mol Biol 14, 949–967 23 Schena M, Lloyd AM & Davis RW (1991) A steroidinducible gene expression system for plant cells Proc Natl Acad Sci USA 88, 10421–10425 24 Lloyd AM, Schena M, Walbot V & Davis RW (1994) Epidermal cell fate determination in Arabidopsis: patterns defined by a steroid-inducible regulator Science 266, 436–439 25 Zuo J, Niu QW & Chua NH (2000) Technical advance: an estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants Plant J 24, 265–273 26 Tavva VS, Dinkins RD, Palli SR & Collins GB (2006) Development of a methoxyfenozide-responsive gene switch for applications in plants Plant J 45, 457– 469 27 Tavva VS, Dinkins RD, Palli SR & Collins GB (2007) Development of a tightly regulated and highly inducible ecdysone receptor gene switch for plants through the use of retinoid X receptor chimeras Transgenic Res 16, 599–612 28 Palli SR, Kapitskaya MZ, Kumar MB & Cress DE (2003) Improved ecdysone receptor-based inducible gene regulation system Eur J Biochem 270, 1308–1315 29 Schardl CL, Byrd AD, Benzion G, Altschuler MA, Hildebrand DF & Hunt AG (1987) Design and construction of a versatile system for the expression of foreign genes in plants Gene 61, 1–11 30 Clough SJ & Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 16, 735–743 FEBS Journal 277 (2010) 4640–4650 ª 2010 The Authors Journal compilation ª 2010 FEBS ... between helices 1–8 of Homo sapiens retinoid X receptor (HsRXR) and helices 9–12 of Locusta migratoria RXR (LmRXR)] as a partner of Choristoneura fumiferana ecdysone receptor (CfEcR), and shows low... sapiens retinoid X receptor (HsRXR) and helices 9–12 of Locusta migratoria retinoid X receptor (LmRXR) A double mutant A62S:T81H of LmRXR A triple mutant A62S:T81H:V123I of LmRXR Luciferase regulated... application; in general, the gene switch should show an undetectable level of transgene expression in the absence of a chemical ligand, followed by rapid and robust induction of transgene expression in