flashing back to a restore point

Báo cáo hóa học: " Research Article Solutions to a Three-Point Boundary Value Problem" docx

Báo cáo hóa học: " Research Article Solutions to a Three-Point Boundary Value Problem" docx

... boundary value problems,” Applied Mathematics and Computation, vol 190, no 2, pp 1168–1177, 2007 G L Karakostas, K G Mavridis, and P C Tsamatos, “Triple solutions for a nonlocal functional boundary ... Higher Education of China 2007035805 References R P Agarwal, Focal Boundary Value Problems for Differential and Difference Equations, vol 436 of Mathematics and Its Applications, Kluwer Academic Publishers, ... positive fixed points of nonlinear operators on ordered Banach spaces,” Computers & Mathematics with Applications, vol 42, no 3–5, pp 313–322, 2001 A Boucherif and N Al-Malki, “Nonlinear three -point third-order...

Ngày tải lên: 21/06/2014, 05:20

20 303 0
Bringing a Dying Brand Back to Life

Bringing a Dying Brand Back to Life

... and around the business Many arranged to play ten to 15 games a year at their facilof the organization’s oldity in Orlando, and we timers had to leave They have our annual training couldn’t adapt ... order to become relevant again; second, customers had to be shown that we really cared about them; and third, an accountable organization had to be created a real business Before we get to that, ... get in touch with that group and say, “We’re coming to town, what can we for you?” For example, I might donate my time and speak at a fund-raising dinner at an organization’s annual meeting To get...

Ngày tải lên: 24/10/2013, 08:20

16 499 1
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... of human DIDO isoforms and were searched against PFAM [22,23] and SMART [24] databases to automatically detect domains; they were further used as queries against NCBI databases using PSIBLAST [25,26] ... that DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions...

Ngày tải lên: 07/03/2014, 21:20

7 658 0
Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

... cells to necrosis mediated by tumor necrosis factor J Exp Med 187, 1477–1485 62 Sasazuki T, Okazaki T, Tada K, Sakon-Komazawa S, Katano M, Tanaka M, Yagita H, Okumura K, Tominaga N, Hayashizaki ... Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C (2010) A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO ⁄ IKKgamma to dampen the host NF-kappaB-mediated inflammatory response Nat Cell Biol 12, ... early after receptor ligation whereas the cell death regulators FAS-associated via death domain (FADD) and caspase are recruited to a pro-apoptotic complex that forms slowly in the cytoplasm This...

Ngày tải lên: 28/03/2014, 23:20

11 503 0
do you really need back surgery a surgeons guide to neck and back pain and how to choose your treatment jul 2004

do you really need back surgery a surgeons guide to neck and back pain and how to choose your treatment jul 2004

... York Auckland Bangkok Buenos Aires Cape Town Chennai Dar es Salaam Delhi Hong Kong Istanbul Karachi Kolkata Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi Saõ Paulo Shanghai Taipei Tokyo ... relief They are also called nonsteroidal anti-inflammatories, abbreviated as NSAIDs, to distinguish them from the steroidal anti-inflammatory medications The prototypical anti-inflammatory, and the ... even leading to death A narcotic is also a particularly “personal” medication in that it produces tolerance: That is, an individual may require greater and greater amounts to achieve the same amount...

Ngày tải lên: 11/06/2014, 10:33

353 427 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately ... stability of Jensen’s functional equation J Inequal Pure Appl Math (2003) Article doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed -point approach to the stability of a ... stability of approximately additive mappings J Math Anal Appl 184, 431–436 (1994) doi:10.1006/jmaa.1994.1211 Jung, S-M: Hyers-Ulam-Rassias Stability of Functional Equations in Nonlinear Analysis Springer,...

Ngày tải lên: 20/06/2014, 22:20

7 429 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 184, 431–436 (1994) doi:10.1006/jmaa.1994.1211 Skof, F: Local properties and approximation...

Ngày tải lên: 20/06/2014, 22:20

14 480 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Fuzzy Stability of an Additive-Quadratic-Cubic Functional Equation" pdf

Báo cáo hóa học: " Research Article A Fixed Point Approach to the Fuzzy Stability of an Additive-Quadratic-Cubic Functional Equation" pdf

... Rassias and K Shibata, “Variational problem of some quadratic functionals in complex analysis,” Journal of Mathematical Analysis and Applications, vol 228, no 1, pp 234–253, 1998 68 K Ravi and ... vruta, A generalization of the Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 18 J M Rassias, ... functional 1.1 in fuzzy Banach spaces for an even case Throughout this paper, assume that X is a vector space and that Y, N is a fuzzy Banach space Generalized Hyers-Ulam Stability of the Functional...

Ngày tải lên: 21/06/2014, 20:20

24 307 0
Báo cáo hóa học: "Research Article Existence and Uniqueness of Smooth Positive Solutions to a Class of Singular m-Point Boundary Value Problems" potx

Báo cáo hóa học: "Research Article Existence and Uniqueness of Smooth Positive Solutions to a Class of Singular m-Point Boundary Value Problems" potx

... Journal of Mathematical Analysis and Applications, vol 185, no 1, pp 215–222, 1994 P Hartman, Ordinary Differential Equations, Brikh¨ user, Boston, Mass, USA, 2nd edition, 1982 a D J Guo and V Lakshmikantham, ... Lakshmikantham, Nonlinear Problems in Abstract Cones, vol of Notes and Reports in Mathematics in Science and Engineering, Academic Press, Boston, Mass, USA, 1988 Y Liu and H Yu, “Existence and uniqueness ... proof of Lemma 1.3 It is easy to verify that An : Xn → Xn C 0, bn is a completely continuous operator and An Xn is a bounded set Moreover, u ∈ C 0, bn is a solution to 2.30 if and only if An u u Using...

Ngày tải lên: 21/06/2014, 20:20

13 209 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx

Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx

... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, ... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol 1, no 2, pp 148–153, 2007 14 S.-M Jung and J M Rassias, “Stability of general Newton...

Ngày tải lên: 22/06/2014, 11:20

7 257 0
Báo cáo hóa học: " Research Article Strong Convergence to Common Fixed Points of a Finite Family of Nonexpansive Mappings" docx

Báo cáo hóa học: " Research Article Strong Convergence to Common Fixed Points of a Finite Family of Nonexpansive Mappings" docx

... Analysis and Applications, vol 211, no 1, pp 71–83, 1997 [5] W Takahashi, T Tamura, and M Toyoda, “Approximation of common fixed points of a family of finite nonexpansive mappings in Banach spaces,” ... of this paper is to show another generalization of Mann and Halpern iterative algorithm to a setting of a finite family of nonexpansive mappings We deal with the iterative scheme x0 ∈ C and xn+1 ... nonexpanding maps,” Bulletin of the American Mathematical Society, vol 73, pp 957–961, 1967 [9] Y Kimura, W Takahashi, and M Toyoda, “Convergence to common fixed points of a finite family of nonexpansive...

Ngày tải lên: 22/06/2014, 18:20

10 256 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx

Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx

... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 [10] Th M Rassias, “On the stability of functional equations and a problem ... paper, we will adopt the idea of C˘ dariu and Radu [12] and prove the Hyersa Ulam-Rassias stability and the Hyers-Ulam stability of the Volterra integral equation (1.2) Hyers-Ulam-Rassias stability ... of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 [6] D H Hyers, G Isac, and Th M Rassias, Stability of Functional Equations...

Ngày tải lên: 22/06/2014, 19:20

9 278 0
Báo cáo hóa học: " ON A FIXED POINT THEOREM OF KRASNOSEL’SKII TYPE AND APPLICATION TO INTEGRAL EQUATIONS" ppt

Báo cáo hóa học: " ON A FIXED POINT THEOREM OF KRASNOSEL’SKII TYPE AND APPLICATION TO INTEGRAL EQUATIONS" ppt

... mapping and so for each a ∈ X, Ua admits a unique fixed point, it is denoted by φ (a) , then Ua φ (a) = φ (a) ⇐⇒ U φ (a) + a = φ (a) ⇐⇒ φ (a) = (I − U)−1 (a) (2.4) m Let u0 be a fixed point of U For each ... equivalent to lim x n →∞ ( Cx n / x n ) = Now we will prove that U + C has a fixed point For any a ∈ X, define the operator Ua : X → X by Ua (x) = U(x) + a It is easy to see that Ua is a k-contraction ... be a Fr´chet space and let C,D : X → X be two operators Suppose that the following hypotheses are fulfilled: (a) C is a compact operator; (b) D is a contraction operator with respect to a family...

Ngày tải lên: 22/06/2014, 22:20

24 283 0
Báo cáo hóa học: " FIXED POINT SETS OF MAPS HOMOTOPIC TO A GIVEN MAP" pot

Báo cáo hóa học: " FIXED POINT SETS OF MAPS HOMOTOPIC TO A GIVEN MAP" pot

... (X ,A) → (X ,A) be a map of a compact polyhedral pair in which X and A have no local cutpoints Suppose (Φ, A ) is a subpolyhedral pair such that (1) AA is not a 2-manifold, (2) A can be by-passed ... [10, Lemma 3.1] to show that there exists a map g1 ,A homotopic to fA with Fix g1 ,A = A via a homotopy HA : A × I → A that is an extension of H | A ×I Consider the homotopy H1 ,A : (A ∪ Φ ,A) × I ... (X ,A) → (X ,A) be a map of a compact polyhedral pair in which X and A have no local cutpoints Suppose (Φ, A ) is a subpolyhedral pair such that (1) AA and all components of X − (A ∪ Φ) are...

Ngày tải lên: 22/06/2014, 22:20

20 357 0
Anh văn lớp 7 - Unit one: Back to school A. Friends ( A1 + A3 ) docx

Anh văn lớp 7 - Unit one: Back to school A. Friends ( A1 + A3 ) docx

... class 7a What’s the new girl’s name? Nam is also in class 7a What class is she in? 3, Practice Listen and repeat Look at the books Who is also in class 7a? (15’) Tells the students to look at ... the tape Asks the students to look at the books and listen to the tape again Work in the small groups Let’s them work in the small groups students stand up and practice Calls some groups to practice ... the dialogue Explains the different between two sentences Nice to see you and Nice to see you again ( can replace see by meet) Answer the questions Opens the tape again Her name is Hoa Makes questions:...

Ngày tải lên: 03/07/2014, 16:21

4 2,1K 2
Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL Lesson 2 : A. Friends (3-5). pps

Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL Lesson 2 : A. Friends (3-5). pps

... Teaching process 1.Class organization: 2.Oral test: -2 pairs of students make dialogues,using the cues: a Hello/nice/meet/too b b.Hi/pleased/see/ again/too c morning /glad/ meet/new classmate/Hoa ... How are you today? + How about you ? +Just fine + Not bad + So am I + Me too - Ss: roleplay the completed dialogues in pairs - T: calls on some pairs to read the dialogues in front of the class ... some Ss to give the answers - T: plays the tape again and asks them to check their answers - T: corrects and gives correct answers 1-c 2-b 3- d 4 -a * Post - listening - T: asks Ss to base on...

Ngày tải lên: 06/08/2014, 16:20

5 587 1
Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 1 : A- Friends (1-2). pps

Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 1 : A- Friends (1-2). pps

... Slap the board T: reads the questions => Ss slap the answers Goodbye a What’s your name? b How are you today? Yes, I am c What class are you in? d Goodbye My name is Hoa Very well, thanks e Are ... T: calls on some pairs to ask and asnwer the questions in front of the class - T: corrects then gives the correct answers Keys: a. Her name is Hoa b.She is in class 7A c.Nam is also inclass 7A *Production: ... again, then work in pairs - T: calls on some pairs to ask and answer in front of the class - T: corrects and gives the correct answers a She is from Hue b She is staying with her uncle and aunt...

Ngày tải lên: 06/08/2014, 16:20

6 572 1
Báo cáo y học: " Isolation of suppressor genes that restore retrovirus susceptibility to a virus-resistant cell line" potx

Báo cáo y học: " Isolation of suppressor genes that restore retrovirus susceptibility to a virus-resistant cell line" potx

... prepared from RC-2 mRNA preparations by standard RT-PCR methods using primers spanning the entire ORF (sequences: 5'ATATAGCTTAAGGCCACCATGGCAGACGATATTGATAT3' and 5'-ATATAGGCGGCCGCTCATCGTCTACTTGGAAC-3'), ... GAR2, a nuclear protein A later report demonstrated that the gene product interacted with the transcriptional activators AP-1 and the estrogen receptors ERa and ERß, and had potent cotransactivation ... cDNA insert of the library and the poly (A) addition signal The amplified DNA from each line was directly cloned into the TOPO plasmid DNA and used to transform bacteria In this way cloned cDNAs...

Ngày tải lên: 13/08/2014, 13:20

10 211 0
Báo cáo y học: "Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of treatment, number of clinical contacts and referrals to surgery" pdf

Báo cáo y học: "Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of treatment, number of clinical contacts and referrals to surgery" pdf

... R, Carrino JA, Deyo RA: Imaging strategies for low -back pain: systematic review and meta-analysis Lancet 2009, 373:463-472 Jarvik JG, Deyo RA: Diagnostic evaluation of low back pain with emphasis ... Jordan A: Low Back Pain Rating scale: validation of a tool for assessment of low back pain Pain 1994, 57:317-326 The Danish National Board of Health: [http://www.sst.dk/Indberetning og statistik/DRG ... groups were similar in relation to age, sex, severity of back pain and leg pain, and functional disability (Table 1) The median age for both groups was 48 years and there was almost an even distribution...

Ngày tải lên: 13/08/2014, 14:20

5 352 0
w