first impressions you never get a second chance at love at first sight
Báo cáo khoa hoc:" Endovascular stenting of a chronic ruptured type B thoracic aortic dissection, a second chance: a case report" potx
Ngày tải lên :
11/08/2014, 10:23
... stents (adjacent to the haematoma), which appeared to have only mm of overlap Above the level of the haematoma, an apparent perforation of the second thoracic stent was seen The haematoma was thought ... and back pain continued Further laboratory investigations revealed that he was hypercalcaemic with a corrected calcium of 2.77 mmol/l SCTA revealed a haematoma in the left mid-thoracic cavity associated ... mid-thoracic cavity associated with vertebral body erosion The hypercalcaemia was attributed to this bony erosion and it was postulated that this had been caused by the pulsatile haematoma giving rise to...
- 3
- 120
- 0
Get a Life, Not a Job: Do What You Love and Let Your Talents Work For You
Ngày tải lên :
16/03/2014, 21:45
... S .A de C.V Pearson Education—Japan Pearson Education Malaysia, Pte Ltd Library of Congress Cataloging-in-Publication Data Caligiuri, Paula Get a life, not a job : what you love and let your talents ... personal relationships healthy and satisfying while you pursue your career acts Get a Life, Not a Job is all about you, a way for you to create a plan to reach your ultimate career goal—enjoying as ... this ideal job? • What are the paths to reach the goal of that ideal job? Name your talents: • What are you good at what others say you are good at? • How could I be paid and leverage my talents?...
- 205
- 536
- 0
get a life, you don''t need a million to retire well 4th (2002)
Ngày tải lên :
18/04/2014, 14:05
... AARP’s AgeLine Database at www.aarp.org It contains a searchable electronic database that includes references to books, journal and magazine articles and videos You can also write to: AARP, 601 ... who, at age 70+, cheerfully arrives at work at Nolo every morning at least an hour early Stan’s skill at mining online databases for golden nuggets about retirement and aging has been particularly ... means it adds to the computational reserves in your brain.” Things as simple as learning to operate your computer’s mouse with your left hand or taking a walk in an unfamiliar area are small and...
- 374
- 399
- 0
the undercover economist exposing why the rich are rich the poor are poor--and why you can never buy a decent used car nov 2005
Ngày tải lên :
11/06/2014, 02:14
... is not nearly so natural Let’s say landlords get together and manage to persuade the local sheriff that there should be what in England they call a “green belt,” a broad area of land around the ... becomes a one-hour commute, and people are able to get a seat on the train instead of standing, some decide they’d rather save money and move out of Manhattan Vacant apartments then appear on the market ... real world there are more than two types of farmland, and Bob may have different options to being a farmer—he may be able to get a job as an accountant or driving a cab All these facts complicate...
- 289
- 404
- 0
a guide to the end of the world everything you never wanted to know sep 2004
Ngày tải lên :
11/06/2014, 10:21
... Illustrations Map of the Earth's plates with locations of recent natural disasters Apocalypse, Cassell, 1999 The lithosphere Apocalyse, Cassell, 1999 A tornado National Oceanic and Atmospheric Administration/ ... quake-prone San Andreas Fault that separates western California from the rest of the United States and Turkey's North Anatolian Fault, whose latest movement triggered a major earthquake in 1999 Alternatively, ... to appreciate the notion that just because we have not experienced a particular natural catastrophe before does not mean it has never happened, nor that it will not happen again The Earth has...
- 212
- 445
- 0
d. of c 219. You should get into the habit of ……………… at least one newspaper daily. a. pot
Ngày tải lên :
18/06/2014, 17:20
... Several c Much d A great deal of b 391 Besides rain, ……………… is seldom pure a water naturally b natural water c water of nature d the nature's water b 392.The FDA was set up in 1940 ……………… that ... that if we started at dawn, we would be there by noon a reason b reasoned c reasonable d reasonably b 276 The patient is getting on …………… a satisfied b satisfaction c satisfactory d satisfactorily ... and the house that you own are your ……………… a property b saving c personal belongings d private area a 355 A …………… is an object that help you remember a place you have visited a memory b souvenir...
- 28
- 416
- 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
Ngày tải lên :
26/10/2012, 09:07
... Then the organic phase was washed with water, followed by 1N-HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting residue was chromatographed on silicagel by elution ... relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[51] Additionally, preclinical data suggest ... of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are...
- 11
- 655
- 0
HOW TO GET A JOB.
Ngày tải lên :
06/11/2012, 15:40
... feeling grateful that your mind is racing and alert and be thankful that you feel edgy It means you are alert, that you care about what you are about to do, that you want to win and have the desire ... or at least put it after the important stuff That's what I mean about targeting That's what I mean about looking at things from your target's points of view And this is what you need to prepare, ... simply have to show you' re a thinker, that you know what you' re doing and where you are going, that you are aware of your contribution, that it is your choice and that you can reason with them about...
- 36
- 576
- 0
HOW TO GET a JOB
Ngày tải lên :
12/08/2013, 11:13
... feeling grateful that your mind is racing and alert and be thankful that you feel edgy It means you are alert, that you care about what you are about to do, that you want to win and have the desire ... or at least put it after the important stuff That's what I mean about targeting That's what I mean about looking at things from your target's points of view And this is what you need to prepare, ... simply have to show you' re a thinker, that you know what you' re doing and where you are going, that you are aware of your contribution, that it is your choice and that you can reason with them about...
- 37
- 764
- 1
How to Use This Book to Get a Top Score
Ngày tải lên :
01/11/2013, 15:20
... can reach your goal one step at a time Avoid making goals that are too big and too general—for example, “Learn everything by May 1.” Instead, set dates to learn material throughout March and April ... registration process right away Registration information is available online at www.toefl.org or in the TOEFL exam Bulletin, available at English language centers or at the international student ... crammed for a big test, trying to learn everything at the last minute? If you have, you know that you can’t learn all the material for a major exam in one study session And if you stayed up all...
- 22
- 433
- 0
Tài liệu Báo cáo khoa học: A second independent resistance mechanism to Bacillus sphaericus binary toxin targets its a-glucosidase receptor in Culex quinquefasciatus docx
Ngày tải lên :
19/02/2014, 07:20
... 3, GAAAAGCTTCAGCTGGAA GTTGAACGGCAT; primer 4, AACAAGCTTCACGAA ATCTCCCAGGTCCAC; primer 7, AACAAGCTTGA AATCTCCCAGGTCCACGGT) were used To facilitate cloning of the amplified fragments, primers and ... was found to vary from 54 to 76 bp This might be associated with the occurrence of two possible polyadenlyation signals, a consensus AATAAA and a variant AATTAG (Fig 3, in boldface) In the various ... a large urban area of equatorial Africa Bull World Health Organ 71, 367–375 Kumar A, Sharma VP, Thavaselvam D, Sumodan PK, Kamat RH, Audi SS & Surve BN (1996) Control of Culex quinquefasciatus...
- 13
- 499
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
Ngày tải lên :
20/02/2014, 01:20
... prepared to construct the expression plasmid for the PDH1 gene: 5¢-AGGGATGCATATGAGACCT CTAGATCTAAC-3¢ and 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ ... Sakuraba H, Takamatsu Y, Satomura T, Kawakami R & Ohshima T (2001) Purification, characterization, and application of a novel dye-linked l-proline dehydrogenase from a hyperthermophilic archaeon, ... the extract to 40% saturation, after which it was stirred at °C for h and centrifuged again (20 000 g, 20 min), and additional ammonium sulfate was added to the resultant supernatant containing...
- 11
- 549
- 0
Tài liệu GLOBAL EMPLOYMENT TRENDS 2013 Recovering from a second jobs dip docx
Ngày tải lên :
20/02/2014, 05:22
... Hungary Hungary Ireland Latvia Austria Malta Malta Estonia Bulgaria Slovakia Romania Cyprus Slovenia Luxembourg Germany Belgium Italy Austria Slovakia Czech Rep Greece Portugal Croatia Lithuania ... remains low Forecasts indicate that Asia and Sub-Saharan Africa are more likely to return to their pre-crisis path of structural change than are Latin America and the Caribbean and Central and ... Economies Europe and European (non-EU) Union and CIS East Asia South-East Asia and the Pacific South Asia Latin America and the Caribbean Middle East North Africa Sub-Saharan Africa Source: IMF,...
- 172
- 272
- 0
Tài liệu English as a Second Language Standards docx
Ngày tải lên :
24/02/2014, 18:20
... National Library of Canada Cataloguing in Publication Data Main entry under title: English as a second language standards Compiled by the ESL Standards Committee Cf Acknowledgements These standards ... This year we learned about space and these are some things that I learned I learned that their is a planet named planet x, and I learned that their is an astroid belt My favourite planet is Saturn ... for academic purposes in all content areas ENGLISH AS A SECOND LANGUAGE STANDARDS 15 16 ENGLISH AS A SECOND LANGUAGE STANDARDS PRIMARY STUDENTS WHO ARRIVE IN PRIMARY SCHOOL HAVE A wide variety...
- 62
- 727
- 1
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
Ngày tải lên :
24/02/2014, 18:20
... VCAA provides the only official, up-to-date versions of VCAA publications Details of updates can be found on the VCAA website: www.vcaa.vic.edu.au This publication may contain copyright material ... professionals to understand the stages of first and second language development in children Maintenance of the first language and progress in learning English as a second language are essential pathways ... rhythm and intonation • differentiate the grammatical structure of the new language • adopt new ways of behaving and new values • understand jokes, metaphors and idiomatic language (Adapted from...
- 31
- 1K
- 2
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx
Ngày tải lên :
08/03/2014, 04:22
... 3346 75 Table 2:Sizes of the training data and the test data, baseline performance, and the results The test data is a binary sense-tagged corpus, the TWA Sense Tagged Data Set, manually produced ... manually produced by Rada Mihalcea and Li Yang (Mihalcea, 2003), from text drawn from the British National Corpus We calculated a ‘supervised’ baseline from the annotated data by assigning the most ... Mihalcea and Dan I Moldovan 1999 An automatic method for generating sense tagged corpora In Proceedings of the 16th Conference of the American Association of Artificial Intelligence Rada Mihalcea...
- 6
- 471
- 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
Ngày tải lên :
08/03/2014, 08:20
... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... bp fragment was obtained after the annealing of the two following synthetic oligonucleotides For EGT 5¢GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT ... 5¢-GATCTGATGTCAGCG TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG CCAACATAAGATGGTCATGGTGGCG-3¢ (In order to avoid homologous recombination between the two EGT sequences, codons were degenerate.) For rST3Gal...
- 12
- 584
- 0
Shut Up, Stop Whining, and Get a Life pptx
Ngày tải lên :
10/03/2014, 04:20
... have reached the same level of development as your dog Life can be complicated and hard at times Celebrate that It is what makes us human And interesting And capable of dealing with all that happens ... only make you mad Now let us get clear on this: I am not afraid of making you mad In fact, I enjoy that a bit Because if you get a little mad, that means you are willing to be challenged And while ... implementation of knowledge that is power It is not what you know that matters, it is what you with what you know that matters Knowledge alone will not fix anything It takes effort It does not always...
- 255
- 380
- 0
100 fascinating facts you never knew about the human brain
Ngày tải lên :
11/03/2014, 00:06
... night and have an average of 4-7 dreams each night 64 Brain waves Studies show that brain waves are more active while dreaming than when you are awake 65 Lost dreams Five minutes after a dream, half ... Imaginary playmates A study from Australia showed that children with imaginary playmates between the ages of and tended to be first- born children 42 Reading faces Without any words, you may be able ... after someone around you did? Scientists believe this may be a response to an ancient social behavior for communication that humans still have 80 Brain Bank Harvard maintains a Brain Bank where over...
- 10
- 385
- 0