feminist counseling as a pathway to recovery

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...

Ngày tải lên: 02/11/2012, 11:12

... to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? not often lead to...

Ngày tải lên: 27/12/2013, 20:26

... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...

Ngày tải lên: 18/02/2014, 16:20

... friendly manner, graciously and courteously •  That you want to help them •  To see you as the solution to their problem, and not be seen as your problem •  To be treated as mature adults, not as children ... loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation A pig raised by sheepdogs, learns to herd sheep with a little help A cynical ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart,...

Ngày tải lên: 19/02/2014, 14:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

... didn’t call her sponsor until the next day She wasn’t aware that, as an act of humility, we call as soon as we are aware of the mistake I believe that mistakes are part of our learning and are not ... until it passes so you can see clearly This is a huge one for me! When I get a sudden urge for a discretionary item, as large as a car or as small as a book, I wait at least 24 hours to buy it ... Courage When you find yourself wanting to run away from an unpleasant reality, maybe back into compulsive spending and debting and away from program, take a breath and instead, run headlong toward...

Ngày tải lên: 21/02/2014, 14:20

... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated...

Ngày tải lên: 06/03/2014, 22:21

... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test ... stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after heat-shock treatment J Cell...

Ngày tải lên: 07/03/2014, 12:20

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... and  accounts  for  75%  to 85%  of  the  total  yearly  rainfall,  whereas  the  dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only 15‐25% of the total rainfall.  ...

Ngày tải lên: 22/03/2014, 12:20

... (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information collected at the earlier stage will be analyzed and taken ... two main reasons First, many autonomy experts suggest it as an option to approach the problem According to Little [15], students are not automatically autonomous in the formal classroom The teacher’s ... The teacher strongly believes that autonomy helps learning and that learner training can contribute to promoting learner autonomy Information about learner beliefs about language learning, learner...

Ngày tải lên: 28/03/2014, 11:20

... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94, ... the art Minerva Biotec 14, 121–128 137 Nishiura H, Shibuya Y, Matsubara S, Tanase S, Kambara T & Yamamoto T (1996) Monocyte chemotactic factor in rheumatoid arthritis synovial tissue Probably a...

Ngày tải lên: 30/03/2014, 15:20

... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection, and to ... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...

Ngày tải lên: 18/06/2014, 15:20

... of advanced-tier FETP graduates in Central America region, n = 58.* Country Ministry of Health Epidemiology office Costa Rica El Salvador Guatemala Honduras Nicaragua Dominican Rep Panama*** Total ... periodically as a team to analyse surveillance and conduct outbreak investigations and other public health interventions Standardized evaluations are being planned before (baseline) and after implementation ... from an affected health area and the presence of an intermediate-tier FETP graduate In addition to natural disasters, there have been national-scale outbreaks in which FETP trainees played a key...

Ngày tải lên: 18/06/2014, 17:20

... PSA as a tumour marker and ALP as a bone formation marker Methods This imaging study was performed as a pilot substudy of an open-label phase trial of Alpharadin in patients with bone metastases ... in clinical trials, to the extent that bone metastases are often regarded as a non-measurable disease [4] Criteria exist which use radiographic changes to measure response in bone metastases, but ... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured...

Ngày tải lên: 21/06/2014, 02:20

... Create Computer Viruses Virus writers can have various reasons for creating and g spreading malware Viruses have been written as: • • • • • • • • • Research projects Pranks Vandalism To attack ... load than normal Computer's hard drive constantly runs out of free space Files have strange names which are not recognizable Programs act erratically Resources are used up easily Hardware Threats ... program ti due to i l t f data in Software Attacks: • Intentionally launched malicious programs enable the attacker to use the computer in an unauthorized manner • General Categories: • Viruses and...

Ngày tải lên: 31/07/2014, 04:20

... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type ... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149 ... from animals cannot always be extrapolated to humans Bjelle [36] has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in loadbearing areas On...

Ngày tải lên: 09/08/2014, 08:22

... (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg suspension ... USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the data in the figures The data were analyzed using two-way analysis of variance ... M, Aota S, Omata T, Tuzuike N, Itokazu Y, Oka H, Tamaki H, Nakamura T: Methotrexate maintains bone mass by preventing both a decrease in bone formation and an increase in bone resorption in adjuvant-induced...

Ngày tải lên: 09/08/2014, 10:21

... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The current genetic maps contain around ... and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs (24!, the average number...

Ngày tải lên: 09/08/2014, 18:21

... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...

Ngày tải lên: 11/08/2014, 00:23