eye anatomy of a dog
Tài liệu Eye of a Dog ppt
Ngày tải lên :
23/12/2013, 10:16
...
Gather your drawing pencils and prepare to add shading to Shadow’s eye. Shading refers to the
various shades of gray (values) in a drawing that make drawings look three-dimensional. Values
are ... included graphic design, and teaching recreational drawing and
painting classes. As supervisor of her community’s recreational art department, Brenda hired and
trained teachers, and designed ... honored with a commendation from the Royal Canadian
Mounted Police, and in 1994, she was awarded a Certificate of Membership from “Forensic
Artists International”.
Her home-based art career included...
- 10
- 348
- 0
Tài liệu Eye of a Dog docx
Ngày tải lên :
24/12/2013, 03:15
... Drawing People: Winner of the Alpha-Penguin Book of the
Year Award 2004, Alpha - Pearson Education – Macmillan, Indianapolis, IN, this 360 page
book is available on various websites and in major ... was awarded a Certificate of Membership from “Forensic
Artists International”.
Her home-based art career included graphic design, and teaching recreational drawing and
painting classes. As ... learning,
and the aid of assorted “Learn to Draw” books. During Brenda’s twenty-five year career as a
self-educated civilian forensic artist, numerous criminal investigation departments have...
- 10
- 483
- 0
Tài liệu ANATOMY OF A ROBOT pdf
Ngày tải lên :
19/01/2014, 19:20
... Gantt chart, a standard project management tool
Jul'00
Jul'00Jul'00
Jul'00 Aug'00
Aug'00Aug'00
Aug'00 Sep'00
Sep'00Sep'00
Sep'00 Oct'00
Oct'00Oct'00
Oct'00 ... someone
unacquainted with the project. The plan’s schedule can be drawn up using a standard
software package (such as Microsoft Project) in a Gantt bar chart format (about 10 to
20 bars). A portion of ...
Hardware Hardware
Hardware
Obtain reference
designs
Operate and Analyze
Partition System
Measure RF and bit
rates
Schematics
Fabrication
Assembly
Debug
Schematics (respin)
Fabrication
Assembly
Debug
Embedded...
- 321
- 881
- 0
Tài liệu Anatomy of a Robot P2 pdf
Ngày tải lên :
19/01/2014, 20:20
... appropriate
amount of water, and reliability is paramount.
■ The average toaster is great at browning bread in a repeatable manner.
■ You can probably walk through a completely dark room, touch a few well-known
milestones, ... case, a large actuator gain can make the system
unstable and lead to failures. Whenever altering the gain, remember to reevaluate
and retest the dynamic performance of the control system.
Realize ... is
desireable. Just be aware that increasing the gain of the actuator adds expense and
will adversely affect the dynamic (nonsteady state) behavior of the control system
as we will see later. In...
- 20
- 388
- 0
Tài liệu Anatomy of a Robot P1 ppt
Ngày tải lên :
19/01/2014, 20:20
... 11:54 AM Page i
10 CHAPTER ONE
FIGURE 1-2 A Gantt chart, a standard project management tool
Jul'00
Jul'00Jul'00
Jul'00 Aug'00
Aug'00Aug'00
Aug'00 Sep'00
Sep'00Sep'00
Sep'00 ... can be drawn up using a standard
software package (such as Microsoft Project) in a Gantt bar chart format (about 10 to
20 bars). A portion of such a Gantt chart is shown in Figure 1-2. It’s large ... 0-07-141657-9
All trademarks are trademarks of their respective owners. Rather than put a trademark symbol after
every occurrence of a trademarked name, we use names in an editorial fashion only, and to...
- 30
- 390
- 1
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
Ngày tải lên :
24/01/2014, 20:20
... created maps containing as many as 518 million of these hyperlinks, a
significant sample of the total. These maps allow rapid calculation of a web page’s "PageRank", an
Of course a distributed ... a
text-based search engine, such as images, programs, and databases. This makes it possible to return web
pages which have not actually been crawled. Note that pages that have not been crawled can cause
problems, ... several other extensions to PageRank,
again see [Page 98].
Another intuitive justification is that a page can have a high PageRank if there are many pages that point
to it, or if there are some...
- 20
- 571
- 0
Anatomy of a Health Scare: Education, Income and the MMR Controversy in the UK doc
Ngày tải lên :
22/03/2014, 14:20
... years of data.
portion of lone parents, number of GPs, and average age of adults, has not been uniform across areas.
19
2.5 percentage points gap is only slightly larger than the estimated gap ... high and low educated parents.
21
IZA DP No. 3590
Anatomy of a Health Scare:
Education, Income and the MMR Controversy in the UK
Dan Anderberg
Arnaud Chevalier
Jonathan Wadsworth
DISCUSSION PAPER ... area fixed effects control for any time-invariant differences across
HAs associated with level differences in uptake rates. The variable z
jt
measures the fraction of
adults of parenting age in area...
- 58
- 521
- 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
Ngày tải lên :
23/03/2014, 04:21
... plasmid.
The gene was amplified from this plasmid by PCR using for-
ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT
CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-
TATACTATCCTCGAGCCACTGCATATCACGGATAC
GACGC-3¢. ... cDNA for cB using forward primer
5¢-ACTTATACTACT
CATATGGGGAAGATCACTTTTT
ACG-3¢ and reverse primer 5¢-ACTTATACTATC
CTCG
AGATAAAAATCCATCACCCG-3¢, and digested this with
restriction enzymes NdeI and ... chromatography was performed on a
SMART chromatographic workstation (Pharmacia, GE
Healthcare Biosciences AB, Uppsala, Sweden), using an
analytical Superdex-200 column (Pharmacia) (bed volume
approximately...
- 13
- 430
- 0
The Anatomy of Clickbot.A pdf
Ngày tải lên :
30/03/2014, 16:20
... fict-search.com a referral fee every time that it displays an
ad that links to great-online-magazine.com on a search results
page, and that ad is clicked on by a user.
The Anatomy of Clickbot .A
Neil Daswani, ... follows a link associated with a re-
ferral account, the agent arrives at a landing page. A landing
page is a web page that an advertiser pays a search engine or re-
ferrer to direct traffic to. ... upper-bound estimate of the dollar
amount of attempted fraud against a major search engine:
Estimated Dollar Fraud = Total bot clicks * P(click may lead
to an ad) * P(click on an ad) * Average Cost Per...
- 11
- 575
- 0
The Design and Implementation of a Log-Structured File System
Ngày tải lên :
12/09/2012, 15:05
... log as the most up to date ‘‘truth’’ about
the state of the data on disk. The main difference is that
database systems do not use the log as the final repository
for data: a separate data area is ... purpose.
The separate data area of these database systems means
that they do not need the segment cleaning mechanisms of
the Sprite LFS to reclaim log space. The space occupied
by the log in a database system ... The bandwidth of each of the five phases is
shown separately. Sprite LFS has a higher write bandwidth and
the same read bandwidth as SunOS with the exception of sequen-
tial reading of a file that...
- 15
- 1.4K
- 0