eye vision of a dog

Tài liệu Eye of a Dog ppt

Tài liệu Eye of a Dog ppt

... Gather your drawing pencils and prepare to add shading to Shadow’s eye. Shading refers to the various shades of gray (values) in a drawing that make drawings look three-dimensional. Values are ... included graphic design, and teaching recreational drawing and painting classes. As supervisor of her community’s recreational art department, Brenda hired and trained teachers, and designed ... honored with a commendation from the Royal Canadian Mounted Police, and in 1994, she was awarded a Certificate of Membership from “Forensic Artists International”. Her home-based art career included...

Ngày tải lên: 23/12/2013, 10:16

10 349 0
Tài liệu Eye of a Dog docx

Tài liệu Eye of a Dog docx

... Drawing People: Winner of the Alpha-Penguin Book of the Year Award 2004, Alpha - Pearson Education – Macmillan, Indianapolis, IN, this 360 page book is available on various websites and in major ... was awarded a Certificate of Membership from “Forensic Artists International”. Her home-based art career included graphic design, and teaching recreational drawing and painting classes. As ... learning, and the aid of assorted “Learn to Draw” books. During Brenda’s twenty-five year career as a self-educated civilian forensic artist, numerous criminal investigation departments have...

Ngày tải lên: 24/12/2013, 03:15

10 483 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. ... cDNA for cB using forward primer 5¢-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3¢, and digested this with restriction enzymes NdeI and ... chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), using an analytical Superdex-200 column (Pharmacia) (bed volume approximately...

Ngày tải lên: 23/03/2014, 04:21

13 430 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data area is ... purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space occupied by the log in a database system ... The bandwidth of each of the five phases is shown separately. Sprite LFS has a higher write bandwidth and the same read bandwidth as SunOS with the exception of sequen- tial reading of a file that...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... in nature to a data manager which fails to free data, but is easier to detect and prevent. • Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... data. It is usually made in response to a pager_data_request call made to the data manager by the kernel. Typical data managers will only provide data upon demand (when processing pager_data_request ... it initiates a cache replacement. A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and execute)...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
List the components of a radio system

List the components of a radio system

... 25 Signal Strength (continued) 19 Multiple Access (continued) • Code Division Multiple Access (CDMA) (continued) – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions ... communication today • Except for broadcast radio and television • Half-duplex transmission – Sends data in both directions • But only one way at a time – Used in consumer devices such as citizens band ... shape of the input signal exactly 11 Multiple Access (continued) • Frequency Division Multiple Access (FDMA) – Divides the bandwidth of a channel into several smaller frequencies bands – Cable...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

... concrete rather than abstract; each moral quality was personified as a deity; no truly historical sense emerged; learning consisted of a gigantic catalogue of names and attributes; and the law was not codified. ... lineages of mitochondrial DNA exist among the San (‘Bushmen’) of southern Africa and the Biaka Pygmies of the modern Central African Republic. About 100,000 years ago, some of these anatomically ... 20,000 years ago, appeared at that date also in southern Africa, spread into western and northern Africa during the next 10,000 years, and thereafter became ubiquitous. Arrow-heads, appearing about...

Ngày tải lên: 21/09/2012, 10:39

386 1,2K 4
Guest the meaning of a word

Guest the meaning of a word

... hurl, cast)]. offer: ob-và ferre [Gồm các biến dạng fer và lat (Latin: line, bring, carry)]. insist: in-và stare [Các biến dạng c a stare là sta, stat, sti, và sist (Greek: standing, stay, make ... guest the meaning of a word Could you guest the sign of a new word? Yes, Of couse. This is 20 prefix and 14 root-word helping you improve your vocabulary. You can guest the meaning of 14.000 ... talk, speech, speak; word)]. aspect: ad-và specere [Gồm có 2 dạng spec và spic (Latin: see, sight, look, appear, behold, and examine)]. uncomplicated: un-, com-,và plicare [Có 11 biến dạng sau:...

Ngày tải lên: 02/10/2012, 12:07

2 872 1
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... Data Service approved the collection and recording of the study data. Statistics Data were recorded into a database designed with File Maker (FileMaker Inc., Santa Clara, CA, USA). We used Table ... time of arrival, time of departure and time patient care is ended), vital parameters, patient data, applied interven- tions, drugs used and a brief summary of the mission. The charts also allow ... (quality of airway man- agement) and whether ETI attempts were successful and without major complications (patient safety). Materials and methods Stavanger HEMS The Stavanger HEMS is part of...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... this article as: Lindström et al.: Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators. Scandinavian Journal of Trauma, Resuscitation ... emergency medical call centre organization reform in Finland. Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area of southern Finland ... 54(6):689-695. 6. Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure. Finland Helsinki; 2005, 56. 7. Kuisma K, Boyd...

Ngày tải lên: 25/10/2012, 10:02

5 496 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... ra- tionale after the initiation of NARP. Also carbapenem resistance rates of Pseudomonas spp and Acinetobacter spp decreased correlating with decreased consump- tion of carbapenems after NARP ... consump- tion calculated by two-tailed Spearman’s coefficient (r) for non-parametric correlations. A P value of less than 0.05 was regarded as significant. Software package STATA 9.0 (USA) was used ... data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara. Antimicrobial resistance profiles of 14,233 selected microorganisms...

Ngày tải lên: 25/10/2012, 11:00

6 692 0
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

... Publisher. All rights reserved Case Report Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane Adele Scattarella 1 , Andrea Ballini 1  , ... Roberto Grassi 1 , Andrea Carbonara 1 , Francesco Ciccolella 1 , Angela Dituri 1 , Gianna Maria Nardi 2 , Stefania Cantore 1 , Francesco Pettini 1 1. Department of Dental Sciences and Surgery, ... Bichat's buccal fat pad to close oroantral communications in irradiated maxilla. J Oral Maxillofac Surg. 2010 Jan;68(1):229-30. 9. Hernando J, Gallego L, Junquera L, Villarreal P. Oroantral...

Ngày tải lên: 25/10/2012, 11:48

5 573 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

... Publisher. All rights reserved Research Paper Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer ... 1N-HCl and again water. The organic layer was dried over Na 2 SO 4 and evaporated. The resulting residue was chromatographed on silicagel by elution with chloroform/ethanol (9 : 1) and further ... the series of images T1 relaxation times were calculated by a non-linear fit (Leven- berg-Marquardt algorithm) of the signal amplitudes using the exponential saturation recovery relation- ship....

Ngày tải lên: 26/10/2012, 09:07

11 656 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... basic characteristic about product, which was described by color, trademark, and the package of product. Each of the products of a multinational join stock company has a separate trademark and ... The Marketing Strategy of a multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always kept its prices as competitive ... another main task of the department. • Financial and Accounting department: this department deals with all financial and accounting matters. Another main function is to manage the use of capital to...

Ngày tải lên: 27/10/2012, 16:51

25 624 8
 Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... MCG data and angiographic data. Fi- nally, microvascular disease, not associated with de- finable epicardial vessel lesions on angiography, re- sulting in myocardial ischemia can create a false ... that each patient was already scheduled for the reference coronary an- giography for any indication. Coronary angiographic data was recorded digitally and on cine angiographic film and was ... using the US manufactured de- vice and analyzed using the US-based software and New York data analysis center from pa- tients in the US, Germany, and Asia was completed. A total of 1076 patients from...

Ngày tải lên: 03/11/2012, 10:58

13 684 0

Bạn có muốn tìm thêm với từ khóa:

w