extracting a dataset to an xml file

... command SqlDataReader dr = cmd.ExecuteReader( CommandBehavior.SchemaOnly | CommandBehavior.KeyInfo); // Create a table of the schema for the DataReader DataTable schemaTable = dr.GetSchemaTable( ... dc.ColumnMapping = MappingType.Attribute; // Write the DataSet to an XML document XmlDataDocument ordersXml = new XmlDataDocument(ds); // Load the XML transformation XslTransform xslt = new XslTransform( ... then applied to the XML document and the results are output to an XmlReader The style sheet transforms the XML format for the data in the DataSet to the format required for the ADO XML data section...

Ngày tải lên: 14/12/2013, 18:16

... SqlXmlParameter param = cmd.CreateParameter( ); param.Name = "@CustomerID"; param.Value = customerId; // Create the DataSet DataSet ds = new DataSet( ); // Create the SQL XML DataAdapter SqlXmlAdapter ... query as an XmlReader object ) CreateParameter( ) Creates a SqlXmlParameter object used to pass parameters to a command using the Name and Value properties ClearParameters( ) Clears SqlXmlParameter ... Fills a DataSet with the XML data retrieved from the SQL Server database Update Updates the SQL Server database with the changes made to the DataSet For more information about the SQLXML Managed...

Ngày tải lên: 21/01/2014, 11:20

... three ways to synchronize a DataSet with an XmlDataDocument: Method Populate a DataSet with both schema and data Synchronize it with a new XmlDataDocument, initializing it with the DataSet in ... allows real-time, synchronous access to both a DataSet and its XML representation in an XmlDataDocument object The synchronized DataSet and XmlDataDocument work with a single set of data The solution ... { DataSet ds = new DataSet( "Orders_OrderDetails"); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]);...

Ngày tải lên: 21/01/2014, 11:20

... Here are descriptions of the three DiffGram sections: The DataInstanceName is the name of the DataSet or DataTable This block contains the current version of the data containing ... method cannot be used to generate a DiffGram A DataSet can be loaded from an XML DiffGram by specifying an XmlWriteMode of DiffGram when calling the ReadXml( ) method [ Team LiB ] ... original and current values for the contents of a DataSet It does not include any schema information The DiffGram is also the primary serialization format used by the NET Framework to persist and...

Ngày tải lên: 21/01/2014, 11:20

... instance, we need to take the loaded XML data, place it into indexed positions of an array, and set that array as the data provider for the playlist_lb instance As a result, our loaded XML data appears ... Play button again, and the interface is updated Because this application uses an XML document to define available songs, editing that file' s data will automatically be reflected in the application ... tempArray, each with label and data properties representative of song names and song filenames, as just described The last action within the onLoad event handler sets tempArray as the data provider...

Ngày tải lên: 07/11/2013, 15:15

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...

Ngày tải lên: 26/01/2014, 10:20

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...

Ngày tải lên: 18/03/2014, 01:20

... human death have changed dramatically during our history as a species, but maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and ... accidental death T h e gradual physical weakening that accompanies aging will make an animal more likely to be caught by a predator; diminished immune capacity can make us more suscep8 AGING S ... age 30 Skin and hair Loss of subcutaneous fat; appearance of wrinkles, pigmentation Graying of hair at all body sites; loss on top of head; some facial hair may increase Nails thicken Heart and...

Ngày tải lên: 11/06/2014, 05:26

... radiant with joy On the walls, different patterns of modern paintings were hung: charcoal drawings, pencil drawings and oil paintings were on display Most of them reflect daily activities and ... into a world of imagination and dreams As I strolled through the exhibition halls, I heard the voices of lecturers who were telling the visitors about the artists and their works An oil painting ... brought me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings to keep as souvenirs...

Ngày tải lên: 22/07/2014, 04:20

... - - - ... ?> - - - ... shows how to delete columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch...

Ngày tải lên: 24/12/2013, 06:17

... System.EventArgs e) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... FileAccess.Read); // Create an XmlTextReader using the file stream XmlTextReader xtr = new XmlTextReader(fs); try { // Read the schema into the DataSet DataSet ds = new DataSet( ); ds.ReadXmlSchema(xtr); // ... XML data The XmlTextReader does not validate the XML For validation, use the XmlValidatingReader class The XmlTextWriter and XmlTextReader classes conform to the W3C XML 1.0 and the Namespaces...

Ngày tải lên: 26/01/2014, 10:20

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...

Ngày tải lên: 02/11/2012, 11:12

Ngày tải lên: 06/11/2012, 10:35

... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...

Ngày tải lên: 06/11/2012, 10:35

... familiar with Agreeing and Disagreeing, Giving an Explanation or Making an Argument Some thought that Cause and Affect pattern of essay organization should be paid more attention to TWE preparation It ... Agreeing and disagreeing (AD); Stating a preference (PR); and Giving an explanation (EX) that learners can flexibly apply to their writing with each pattern of essay organization Sometimes, a combination ... organizations of cause and effect essay: block and chain In block organization, all the causes are discussed as in a block and the all the results are mentioned in another block In chain organization,...

Ngày tải lên: 06/11/2012, 10:35

... have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily to ... parents are important teachers when children are small but they cannot be the best ones all the time There’s still a gap between children and parents in every family WRITING PAPER Name: Group A Paper: ... need to learn from other sources WRITING PAPER Name: Group A Paper: 02F6g Task: 02 AD Write: It’s said that parents are always the best teachers but we strongly disagree with the above statement...

Ngày tải lên: 06/11/2012, 10:35

... way, the VSS SDK contains a set of test VSS scripts that can be used to backup and restore a SQL/MSDE database, and then verify that the restore was succesful Thanks, Adi Yoshihiro Kawabata Jan ... away, all the created shadow copies are going away too In fact, this is a convenient feature for a backup application; for example if that application crashes, then you won't have leaking shadow ... a neat trick that allowed us to avoid defining a separate CMD script At the same time, the test allows us to detect what to when we are inside VSHADOW remember, all we wanted to is to copy a...

Ngày tải lên: 21/03/2013, 10:27

... Read all rows from the DataReader while(dr.Read( )) { // Read the row from the DataReader into an array dr.GetValues(aData); // Add the row from the array to the DataTable dataTable.Rows.Add(aData); ... key to the table dataTable.PrimaryKey = (DataColumn[])pkCols.ToArray(typeof(DataColumn)); // Add the table to the DataSet ds.Tables.Add(dataTable); object[] aData = new object[dataTable.Columns.Count]; ... databases inherit—defines an overload of the Fill( ) method that converts a DataReader to a DataSet, this method is declared protected and cannot be accessed (unless you write a custom DataAdapter)...

Ngày tải lên: 07/11/2013, 13:15

... English Thai English English Vietnamese Vietnamese m t s qu c gia v vựng lónh th Qu c gia Cambodia Cambodia Indonesia Lao People's Dem Lao People's Dem Malaysia Malaysia Singapore Taiwan Thailand United ... Trey Damrey Bakutut Pa boo Pa bou Goby Belantuk Soon hock Marble goby Pla boo jak Marble goby Marbled sleeper Cỏ Bong Cỏ B ng t ng Ngụn ng Khmer Khmer Malay Laotian Laotian English Malay Cantonese ... 1758 - animals Subkingdom: Bilateria (Hatschek, 1888) Cavalier-Smith, 1983 - bilaterians Branch: Deuterostomia Grobben, 1908 - deuterostomes Infrakingdom: Chordonia (Haeckel, 1874) Cavalier-Smith,...

Ngày tải lên: 06/12/2013, 19:34

... interop While the data can be loaded into a DataSet in this way, there is no way to reconcile the changes made to the data in the DataSet with the data source underlying the ADO object This must ... DataTable dt = new DataTable("Orders"); (new OleDbDataAdapter( )).Fill(dt, rs); conn.Close( ); // Bind the default view of the dt to the grid dataGrid.DataSource = dt.DefaultView; Discussion ... ADO object This must be explicitly handled There is no FillSchema( ) method which allows the schema of an ADO Recordset to be retrieved into a DataSet [ Team LiB ] ...

Ngày tải lên: 14/12/2013, 18:16