... Structure of the Thesis The thesis consists of chapters: Chapter I presents the background and rationale of the study, the aims, the research questions, the scope, the significance, the limitations ... teachers of English were interviewed for in depth information The results of the research revealed that the speaking lessons are relatively communicative in the light of CLT principles and that they ... terms of material textbook adaptation, materials adaptation should be based on the results of materials evaluation Of course different materials have different potential areas for adaptation...
Ngày tải lên: 14/09/2015, 09:21
Ngày tải lên: 27/08/2016, 08:18
Designing an esp syllabus for the second-year students of library study at the national teachers training college
... consideration of the students needs and the objectives of the course, together with the institutional bias of the teaching institution It implies that a material designer must analyze the needs of the ... the administrators) 3.3.3.4.2 The organization of the syllabus Basing on the results of the surveys and the official requirements of the college, we have offered an ESP reading syllabus for the ... Furthermore, students at University of Cultures are of higher level of English proficiency than that of the students at NTTC And the target students at NTTC are lower in comparison with that at...
Ngày tải lên: 07/11/2012, 14:36
An english-vietnamese cross-cultural study of keeping face at the first encounter
... communication at the first encounter 25 Situation a To business partner of higher status in the office b To their business partner of equal status in the office C To their business partner of lower status ... terms of their evaluation of power, age and gender realizing small-talk starters at the first meeting in the contexts studied? If yes, how their evaluations affect their choice of politeness strategies? ... requested to provide information about: Their nationality Their age Their sex Their marital status Their occupation Their residence Their acquisition of foreign language The informants are assured...
Ngày tải lên: 07/11/2012, 14:54
EVALUATION OF HEALTH RISKS IN THE WASTEWATER RECLAMATION IN THE ABUKUMA WATERSHED, JAPAN
... all of the shortage of water is replaced by the reclaimed wastewater Damage from the shortage of water The damage [%•day] from the shortage of water is quantified by the product of the percent of ... discharge at the intake point The wastewater reclamation is simulated in Fukushima city located at the middle reach of the Abukuma river in Japan In this city with the population of 0.3 million, the ... population were evaluated The shortage of water was predicted using the matrix of simultaneous probability of river discharge levels on two consecutive days at the intake point of the water treatment...
Ngày tải lên: 05/09/2013, 09:08
Shaking a box of sand II – at the jamming limit, when shape matters
... p(C) is the probability that the system is in the orientation configuration C in the steady state, and the sum runs over all the 2n configurations of a system of n grains This can be estimated theoretically ... be the most visited; and, on the other, the flatness hypothesis of Edwards, which states that for large enough systems, the macroscopic entropic landscape of visited configurations is at [15] The ... of the configurations of a column of 12 grains in the zero-temperature steady state with = 1, against the configurations C in lexicographical order The empty circles mark the 26 = 64 ground-state...
Ngày tải lên: 01/11/2013, 08:20
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were found to be 5–10 °C below that of wild-type ... detected by the PDH assay The interaction of E1 (a2b2) with the PSBD was unaffected by any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH ... are located at the mouth of the funnel-shaped active site of E1, at the bottom of which lies ˚ the ThDP cofactor some 20–25 A from the protein ÔsurfaceÕ [14] Thus it may be that these mutations...
Ngày tải lên: 20/02/2014, 23:20
Critical evaluation of diagnostic aids for the detection of oral cancer docx
... standard? Examine a patient population appropriate to the purpose of the test? Use examiners representative of the target or primary clinical providers of the test? Show evidence that the test can distinguish ... Limitations of the study include the fact that two diagnostic specialists performed all examinations rather than generalists and that the data presentation makes it difficult to directly compare the ... designation for each of the 298 patients This is a critical issue because the inclusion of an inordinate number of Class I (suspicious lesion) patients would obviously skew the calculations of sensitivity,...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... different polyunsaturated primary alcohols with the hydroxyl group in Ca, representative of the range of AAO substrates [9,19,33] Most of these alcohols docked in front of the re-side of the isoalloxazine ... docking calculation, and in all cases more than 50% of them clustered together in front of the rectus (re)-face of the isoalloxazine ring of the FAD cofactor This substrate location is shown ... glycoprotein of 70 kDa with dissociable flavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic and aliphatic polyunsaturated alcohols to their corresponding...
Ngày tải lên: 07/03/2014, 11:20
An Investigation into the Implementation of a Brewpub at the New Student Union Building docx
... Assessment of the brewpub’s economic feasibility falls into two categories: assessment of the brewpub’s operating cost and projection of the brewpub’s likely operating revenue In the assessment of the ... Biofuel initiative The brewpub could use biofuel to fuel the stoves heating the mash in the brewing process Biofuels, in addition to being sustainable, also produces CO2 offset of up to 85% The ... adding the malt for mashing The water then has to be boiled for about 1.5 hours which will boil off about one-quarter of the water The amount of energy required including heat losses to the environment...
Ngày tải lên: 08/03/2014, 23:20
Methods of Policy Accommodation at the Interest-Rate Lower Bound ppt
... following the return of the natural rate of interest to its normal level has a dramatic effect on the severity of both the economic contraction and the deflation that occur during the period of the negative ... on the days that these two statements were released In each case, there is a clear, immediate effect on expectations of the future path of the funds rate: OIS rates fall, despite the fact that the ... discussion of the forward path of interest rates with an explanation of the considerations behind it — in particular, of the policy commitments that the anticipated forward path reflects Discussion of the...
Ngày tải lên: 15/03/2014, 14:20
Báo cáo khoa học: "Large-Scale Induction and Evaluation of Lexical Resources from the Penn-II Treebank" potx
... name”) The value of the :cs feature is the constituent structure of the subcategorisation frame, which lists the syntactic CF-PSG constituents in sequence The value of the :gs feature is the grammatical ... extra feature to the generated f-structures, the value of which is the syntactic category of the pred at each level of embedding Exploiting this information, the extracted semantic form for the verb ... verbal subcategorisation classes by means of a statistical shallow parser, a classifier of subcategorisation classes, and a priori estimates of the probability that any verb will be a member of those...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic ... 60 Da The molecular mass of the transferase increased by 750 Da when the enzyme was incubated in the presence of 100 lM propionyl-CoA prior to the measurements, indicating the formation of an ... search, this part of the sequence showed similarity to the smaller subunits of the latter enzymes The catalytic glutamate residue of hetero-oligomeric enzymes belonging to the 3-oxoadipate CoA-transferase...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... features The interaction of Bro1 with Vps4p is regulated by ATP binding rather than hydrolysis, and interaction of Did2p with Vps4p is regulated by neither ATP binding nor ATP hydrolysis Our data ... presence of ATP (Fig 2) To determine whether the decreased binding in the presence of ATP is due to ATP hydrolysis or ATP binding, the effect of ATP on binding to a Vps4p mutant (Vps4p–E233Q) that...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Hepatocyte-specific interplay of transcription factors at the far-upstream enhancer of the carbamoylphosphate synthetase gene upon glucocorticoid induction doc
... stabilization of GR binding to the GRU, and thereby stabilization of the interaction of the coregulators interacting with the nucleoprotein complex formed at the GRU This raises the possibility that ... regulation results from the cooperative binding of transcription factors [12] One of the key determinants of the activation of genes that are under the control of hormone response units is the ... established at the GRUs prior to glucocorticoid activation [4,19] Even though the assembly of the transcription factor complex at the CPS GRU seems to be similar to that of the distal TAT GRU at ) 5.5...
Ngày tải lên: 23/03/2014, 10:20
Taxation of European Companies at the Time of Establishment and Restructuring docx
... states which had not transposed the directive in time.53 When looking at the ratio of SEs and the population of the member states,54 the rather small member state Luxembourg is leading Here the ... .XIX List of Tables .XXI Introduction 1.1 Motivation of the thesis 1.2 Aim of the thesis and object of examination 1.3 Organization of the thesis ... state to another member state and the exit out of an SE With regard to the entry, the four options to establish an SE are assessed: the merger, the foundation of a holding, the foundation of...
Ngày tải lên: 23/03/2014, 11:20
Paper based on transcript of speech presented at the Global Economic Prospects meeting, Peterson Institute for International Economics doc
... discount rate further and faster • They could persuade the US Congress to enact the second fiscal stimulus package They could expand further the scale, the duration, the collateral, and list of counterparties ... reduce the average profit rate But they would also reduce the risk of financial crises and what you and I pay for them Reform Reduce conflict of interest at credit rating agencies by separating the ... just tweaked at the margin Two of the key features of Basel II are that banks can use their own internal models to calculate capital requirements under Pillar 1, and that credit ratings also serve...
Ngày tải lên: 29/03/2014, 03:21
CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx
... externalities at the national level The essential idea behind the EVA system is that state -of- the- art methods are used in all the individual parts of the impact-pathway chain Other comparable ... than the oscillations using the tagging method Consequently, estimates of the δ-concentrations are much more accurate page 14 of 98 Figure 3: An overview of the tagging method The concentration ... The external cost of a specific emitted compound is highly dependent on the location of the emissions in relation to the spatial distribution of the population around the source of interest as well...
Ngày tải lên: 29/03/2014, 14:20
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... repeatedly training on of them and validating on the other y - _ _eY 1A-e" Note that y E (0, 1); each of the two ends of that interval is associated with one of the possible choices We employ the ... generation For example, knowing that hearty is a positive term enables the assignment of the collocation hearty eater to the lexical function entry Motivation The goal of our work is twofold: ... more complicated tests, and also dominates them in terms of information content Some of the tests that have been proposed in the linguistics literature, notably tests that are based on the formal...
Ngày tải lên: 31/03/2014, 06:20