entropy of a source example

Ngày tải lên: 04/10/2012, 10:24

Ngày tải lên: 05/09/2013, 14:58

Ngày tải lên: 22/12/2013, 08:58

... where an emu and a kangaroo were seen at a distance; and the top of the Peak was reached at ten o'clock. I saw the water of the Port as far as N.75 E., so that the whole extent of the ... GUINEA  THE NATIONAL AUSTRALASIAN CONVENTION 1891  THE COMMONWEALTH OF AUSTRALIA  THE BOER WAR  THE GREAT WAR  LANDING ON GALLIPOLI  WHAT ANZAC MEANS These people speak somewhat through ... Australia, as being more agreeable to the ear, and an assimilation to the names of the other great portions of the earth. ACROSS THE MOUNTAINS Source. A Journal of a Tour of Discovery across...

Ngày tải lên: 06/03/2014, 03:21

...

Ngày tải lên: 07/03/2014, 02:20

... dis- cordances What these tables reveal are that: a) the retrieval errors of the various constitutive parameters are far from negligible, even for a discordance of a single parameter that is as small as 10%; b) ... obtain a reliable retrieval of the imaginary part of ℑµ for ±10% discordance of any of the other mechanical descriptors or of x 1 . On the other hand, it was shown that a ±10% discordance of ... to at least one solution, P K = p K . This eventuality is highly improbable in real-life, in that one usually has only a vague idea a priori of the value of at least one of the parameters of...

Ngày tải lên: 18/03/2014, 01:21

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC VL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC VL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC VL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link...

Ngày tải lên: 23/03/2014, 13:20

... criteria to find earthquakes for which this technique can be applied. In the search for potential candidates of earthquake couples, an automatic selection of the available data set was performed ... Fukuyama & 768 Irikura 1986), as well as regional and teleseismic body and surface waveforms (Hartzell 1989; Kanamori ef al. 1992; Velasco, Ammon & Lay 1994). The applicability ... two fault planes. The shape and the area of the ruptured zone is very different in the two cases. For the near-vertical plane, the rupture zone has an elongated shape and may cover an area of...

Ngày tải lên: 23/03/2014, 13:20

... we have sucessfully added gram- matical features to a WSME language model us- ing a SCFG to extract the grammatical informa- tion. We have shown that the the use of gram- matical features in a ... corpus was automatically labelled and man- ually checked. There were two kinds of labelling: POStag labelling and syntactic labelling. The POStag vocabulary was composed of 45 labels. The syntactic ... from a training sample. Each word in the training sample has a part -of- speech tag (POStag) associated to it. These POStags are considered as word categories and are the terminal symbols of our...

Ngày tải lên: 23/03/2014, 19:20

... four different writing systems: romaji, Roman letters re- presenting Japanese sounds hiragana, ordinary syllabic script; katakana, which derives from Chinese characters, and is used for writing non-Chinese loan words; and kanji, ... called manyogana and uses Chinese characters (right column) to represent Japanese phonetic values (left column). the character segment in red was adapted to form the katakana on the left Pictographs ... CE, and is now used for Hindi and other South Asian languages

Ngày tải lên: 02/04/2014, 05:20

... Nakano A, Kawasaki H, Suzuki K, Anraku Y: Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces ... environment and moderate one in the Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domainsFigure 3 Sequence alignment of Family B DNA polymerases from the Archaea, ... evolutionary distances. The gamma shape parameter (alpha) was estimated using the GZ-GAMMA program [30]. The sequence and annotation data for the Mimivirus PolB and intein was deposited to GenBank (accession...

Ngày tải lên: 18/06/2014, 22:20

... Health Sciences, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA and 3 HPER Biomechanics Laboratory, University of Nebraska at Omaha, Omaha, NE, USA Email: James T Cavanaugh* ... produced not by a reallo- cation of attention but by mechanical destabilization, albeit along a temporal rather than a spatial dimension, brought about by articulation and respiratory patterns during ... displacement to estimate the amount of postural sway in the AP plane. Scores are calculated as the angular difference, expressed as a percentage, between the amount of estimated AP pos- tural sway...

Ngày tải lên: 19/06/2014, 10:20

... Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's dis- ease brains. Biochem ... Ikeda S, Tamaoka A: Pravastatin at 10 mg/day does not decrease plasma levels of either amyloid-beta (Abeta) 40 or Abeta 42 in humans. Neu- rosci Lett 2003, 350:161-164. BioMed Central Page 1 of ... isoprenylation of Rac is critical for Rac's subcellular localization, interactions with RhoGDI, anchoring to the plasma membrane and ulti- mately to the activation of inflammatory signaling path- ways...

Ngày tải lên: 19/06/2014, 22:20

Ngày tải lên: 20/06/2014, 04:20

Ngày tải lên: 21/06/2014, 16:20

Ngày tải lên: 21/06/2014, 22:20

Ngày tải lên: 22/06/2014, 18:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 22/06/2014, 22:20