enhancement of transgene expression by ebna 1

... (Fermentas), sequencing was done by Sequencing laboratory, Faculty of Science, Charles University in Prague, Czech Republic) http://www.biomedcentral.com /14 71- 2229/9/44 10 11 12 13 14 Authors' contributions ... and DNA methylation Plant J 2008, 53 :1- 10 Müller E, Lorz H, Lutticke S: Variability of transgene expression in clonal cell lines of wheat Plant Sci 19 96, 11 4: 71- 82 Down RE, Ford L, Bedford SJ, Gatehouse ... several causes Lines 1/ and 1/ 3 were composed of two genetically different clones that were separable by cloning, as shown by comparing 1/ 7d with 1/ 7o or 1/ 3f with other 1/ 3 clones (Figure 5)...

Ngày tải lên: 12/08/2014, 03:20

... Volume 3, Issue 1, 2 012 , pp.73-82 [5] [6] [7] [8] [9] [10 ] [11 ] [12 ] [13 ] [14 ] 81 William G Anderson1, Sanjida Tamanna, David B Sarraf and Peter M Dussinger, Heat Pipe Cooling of Concentrating ... thickness The function of slope and intercept in terms of thickness t is thus derived from the graph f1(t)=[0. 011 xt3]-[0 .12 8xt2]+[0.397xt] (4) f2(t)=[-0.029xt3]+[0.372xt2]- [1. 267xt]-0.005 (5) Thus ... Tolerance No of cells Dimensions (mm) Temperature co-efficient Fill factor (FF) Viscosity of silicone oil (mPas) USP7 Watts 10 V 8.5V 1A 0.82A 10 % 18 320x420x50 NOCT 45oC 0.7 387 Figure Schematic of experimental...

Ngày tải lên: 05/09/2013, 16:11

... was extremely low (4.24 · 10 3 copies of AtZFP 11 lg )1 of total RNA) In 35S:AtZFP 11 Arabidopsis plants, the average AtZFP 11 mRNA level observed was 2.98 · 10 5 copiesÆlg )1 of total RNA, which is 70.3-fold ... 2000 15 00 10 00 500 VGCfEWt:Luc 0.64 3.2 16 80 400 2000 10 000 35S:Luc Methoxyenozide (nM) 0.64 3.2 16 80 400 2000 10 000 0.64 3.2 16 80 400 2000 10 000 0.64 3.2 16 80 400 2000 10 000 0.64 3.2 16 80 ... 2000 10 000 0 0.64 3.2 16 80 400 2000 10 000 Luciferase (RLU·µg 1 protein) B 0.64 3.2 16 80 400 2000 10 000 0 0.64 3.2 16 80 400 2000 10 000 500 0.64 3.2 16 80 400 2000 10 000 Luciferase (RLU·µg 1 protein)...

Ngày tải lên: 16/03/2014, 06:20

... II III IV II 13 1 Mutant –600 ~ 13 1 –600 Mutant –600 ~ 18 8 –600 B –82 18 8 TF-luc : WT mut mut mut n.s 14 Fold change +1 1 n.s n.s 10 11 12 13 14 15 16 – – – – + – – – – + ** 12 10 2 FLAG-CP2 ... -ACCTAAGGTAGGTGCCTAGACAGGGTCTCGGGTCTTTTACTCCACTAGTCGGACCCGCTCCTTACTTCACCCT-CCCTACTTTCCGCTAA AcaC 19 3 acctAAGGT G G C AGaca GGT Tc aGTC TTTACTCCACTaGT g 17 8 15 9 CcG TC TT CTTCcCCC 13 0 CC aC cCC CTAA 11 5 11 3 10 5 +1 CP2 I Homo sapiens :CCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA ... analysis revealed that there are four CP2 consensus sites at positions )17 8 to )15 9, )13 0 to )11 3, )11 5 to )10 5 and )53 to )35 (Fig 1B) Transcription factor CP2 increases the endogenous transferrin...

Ngày tải lên: 23/03/2014, 03:20

... by a grant (KRF-99– 015 DP0398) from the Korea Research Foundation to M.-O L and J P 10 11 12 13 14 17 REFERENCES Pinkoski, M.J & Green, D.R (19 99) Fas ligand, death gene Cell Death Differ 6, 11 74 11 81 ... all-trans-RA (1. 0 lM); (C) PMA (10 ngÆmL )1) and ionomycin (0.5 lM); (D) alltrans-RA (1. 0 lM) with PMA (10 ngÆmL )1) and ionomycin (0.5 lM); E, CsA (1 lgÆmL )1) with PMA (10 ngÆmL )1) and ionomycin ... activation-induced Fas ligand mediate apoptosis of T cell hybridomas: Inhibition of Fas Ligand expression by retinoic acid and glucocorticoids J Exp Med 18 1, 16 73 16 82 Mangelsdorf, D.J., Thummel, C., Beato,...

Ngày tải lên: 24/03/2014, 03:21

... 26.5°, 33.7°, 37.8°, 51. 4°, 54.6°, 61. 5°, 65.0°, 65.8°, respectively, which can be indexed to (11 0), (10 1), (200), ( 211 ), ( 310 ), (11 2), (202), and ( 312 ) planes of tetragonal phase of SnO2 based on ... RF-5301PC spectrophotometer 10 1 200 211 312 11 2 310 10 20 30 40 50 202 60 70 80 2-Theta (degree) Fig XRD pattern of the silica xerogel containing Sm3+ ions (0.5 mol%) and SnO2 nanocrystals (10 wt%) ... Nogami, J Non-Cryst Solids 2 91, 13 7 (20 01) 10 F Gu, S Wang, M Lu, G Zhou, D Xu, D Yuan, J Phys Chem B 10 8, 811 9 (2004) 11 A Patra, D Kundu, D Ganguli, Mater Lett 32, 43 (19 97) 12 N Chiodini, A Paleari,...

Ngày tải lên: 22/06/2014, 22:20

... analyses of locus numbers of transgene in the group transgenic lines indicated that the lines A, B, C and D contained 1, 2, and loci of the uidA gene, Stability of transgene expression in poplar 4 31 ... in 19 92 and 19 93 by GUS fluorometry of transgene activity in group plants indicated that while 436 S Hawkins et al Figure RT-PCR of silenced line pBI -12 1-4 (35S-uidA) PCR with uidA primers (G1G5); ... gene silencing, Curr Opin Plant Biol (19 99) 10 911 3 [3] Bevan M., Binary Agrobacterium vectors for plant transformation, Nucleic Acids Res 12 (19 84) 8 711 87 21 [4] Bishop-Hurley S.L., Zabkiewicz...

Ngày tải lên: 08/08/2014, 01:21

... investigations of the cyanobacterial clock may lead to fundamental insights that are broadly applicable to all organisms http://genomebiology.com/2004/5/4/ 217 10 11 12 13 14 15 16 17 18 19 20 21 22 23 ... determination of circadian gene expression in Synechococcus elongatus PCC 7942 J Biol Rhythms 2004, 19 :10 3 -11 2 Mori T, Johnson CH: Circadian programming in cyanobacteria Semin Cell Dev Biol 20 01, 12 :2 71- 278 ... USA 2002, 99 :15 788 -15 793 Iwasaki H, Taniguchi Y, Ishiura M, Kondo T: Physical interactions among circadian clock proteins, KaiA, KaiB and KaiC, in Cyanobacteria EMBO J 19 99, 18 :11 37 -11 45 Taniguchi...

Ngày tải lên: 09/08/2014, 20:20

... Biochem Biophys Res Commun 19 93, 19 2:553-560 Yen et al Journal of Biomedical Science 2 011 , 18 :32 http://www.jbiomedsci.com/content /18 /1/ 32 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Gibbons C, Dackor ... Journal of Biomedical Science 2 011 , 18 :32 http://www.jbiomedsci.com/content /18 /1/ 32 Page of Figure Co-localization of PKA and nNOS proteins in NTS Confocal microscopic images of NTS showing immunofluorescence ... and Ser1 416 of nNOS (pnNOSS1 416 ) at 10 , 30, and 60 after intra-NTS microinjection of ADM (0.2 pmol) B: Quantified data showing temporal changes in the protein level of phospho-nNOS in NTS of the...

Ngày tải lên: 10/08/2014, 05:21

... inhibition Wu et al Journal of Biomedical Science 2 011 , 18 :74 http://www.jbiomedsci.com/content /18 /1/ 74 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 by c-phycocyanin: a study on ... competitive inhibitor of ATP binding of MAP kinase Wu et al Journal of Biomedical Science 2 011 , 18 :74 http://www.jbiomedsci.com/content /18 /1/ 74 Page of 11 Figure The entry of Cpc into B16F10 melanoma cells ... Journal of Biomedical Science 2 011 , 18 :74 http://www.jbiomedsci.com/content /18 /1/ 74 Page of 11 a dose-dependent manner with the increase of Cpc (0.05 to 0 .1 mg/mL) Moreover, the expression of tyrosinase...

Ngày tải lên: 10/08/2014, 10:20

... 32 34 10 10 0 10 00 10 000 10 10 0 10 00 10 0000 11 Nef expression Nef transcription 13 Monovalent Trivalent Monovalent (GAPDH) Trivalent (GAPDH) 15 Ct OD 450nm 10 000 17 19 Monovalent Trivalent 21 23 ... 25 10 10 0 MOI 10 00 10 000 10 10 0 10 00 10 000 10 0000 MOI Comparison of transgene expression in A549 cells infected with Ad5 monovalent or trivalent formulations Figure Comparison of transgene expression ... Trivalent Monovalent (GAPDH) Trivalent (GAPDH) 28 30 32 10 10 0 10 00 10 000 10 10 0 10 00 10 000 10 0000 14 Pol expression Pol transcription 16 18 22 Ct OD 450nm 20 24 26 28 Monovalent Monovalent Trivalent...

Ngày tải lên: 12/08/2014, 04:21

... http://respiratory-research.com/content/8 /1/ 10 A AdNull (pu) Naive 10 3 10 4 AdPirin (pu) 10 3 10 4 kb 1. 1 Pirin relative RNA expression 10 3 B AdPirin 10 2 10 1 AdNull 10 0 10 -1 103 10 4 Particle units 10 3 C AdPirin 10 2 10 1 AdNull 10 0 10 -1 ... Naive 10 50 CSE (%) 10 2 10 3 10 4 10 2 10 3 10 4 AdNull (pu) AdPirin (pu) B Pirin mRNA expression by TaqMan 10 00 * Relative mRNA level 10 0 10 * * * 0 .1 Naive 10 50 CSE (%) 10 2 10 3 10 4 10 2 10 3 10 4 AdNull ... Research 2007, 8 :10 http://respiratory-research.com/content/8 /1/ 10 Relative RNA expression level 1. 8 1. 6 1. 4 1. 2 1. 0 0.8 0.6 0.4 0.2 Control 10 % 10 0% Control 10 % 10 0% 24 Control 10 % 10 0% 48 Time...

Ngày tải lên: 12/08/2014, 15:20

... 759 IC90 < 10 < 10 < 10 < 10 < 10 45 74 19 2 < 10 10 IC50 < 10 < 10 < 10 < 10 < 10 < 10 10 Patient MM38 DFOS 29 IC90 < 10 < 10 < 10 < 10 < 10 36 51 58 93 IC50 < 10 < 10 < 10 < 10 < 10 Patient MM42 ... 320 12 80 12 80 12 80 2560 12 80 38 66 94 18 5 76 53 83 10 9 11 1 299 Patient MM28 DFOS IC90 20 34 62 93 19 8 < 10 < 10 < 10 < 10 < 10 405 < 10 503 < 10 782 < 10 950 < 10 IC50 < 10 < 10 < 10 < 10 < 10 ... < 10 < 10 < 10 Patient MM33 DFOS 26 2 01 523 6 21 719 IC90 < 10 < 10 < 10 < 10 < 10 33 69 96 < 10 < 10 < 10 IC50 < 10 < 10 < 10 < 10 < 10 < 10 < 10 < 10 Patient MM34 DFOS 32 443 607 759 IC90 < 10 ...

Ngày tải lên: 13/08/2014, 01:20

... CEM-A D17 293 13 ,639 ± 2 ,15 0 (1) b 51, 998 ± 310 8 (3.8)* NDc ND 17 ,10 0 ± 524 (1) 52,372 ± 3,354 (3.0)* ND ND 18 ,093 ± 349 (1) 50, 412 ± 2,997 (2.7)* ND ND 15 ,099 ± 539 (1) 27,294 ± 1, 173 (1. 8)* 26 ,19 7 ... http://www.retrovirology.com/content/3 /1/ 13 A PCE 12 18 hrs ActD U3 12 18 IE-U3 12 18 luc gapdh B IE-PCE 12 18 hrs ActD luc gapdh PCE 30 18 0 25 PI units x103 PI units x103 C 20 15 10 12 ActD hours D 12 0 10 0 80 60 18 12 ActD hours ... 2,955 ± 17 1 (1) b 20, 810 ± 559 (7.0)* 10 ,490 ± 15 9 (3.5) 49,870 ± 28 (16 .8)* 3,809 ± 207 (1) 19 ,644 ± 343 (5 .1) * 13 ,17 4 ± 228 (3.4) 48,085 ± 90 (12 .6)* 3,605 ± (1) 14 ,756 ± 382 (4.0)* 12 ,945 ±...

Ngày tải lên: 13/08/2014, 09:21

... Table 1: Average values of luciferase activity in various tissues Trachea D1 D3 D7 D12 Lung Olfactory bulb Brain LN Spleen 3595 7 718 6046 26 33728 13 6723 18 619 7 47428 14 236 6794 11 677 16 226 61 29 ... Pulmonary Tuberculosis J Immunol 2004, 17 3:6357-6365 Page of (page number not for citation purposes) Genetic Vaccines and Therapy 2008, 6:5 10 11 12 13 14 15 16 17 18 19 20 Santosuosso M, McCormick S, ... fibrotic reactions J Clin Invest 19 96, 97 :11 02 -11 10 Lei XF, Ohkawara Y, Stämpfli MR, Gauldie J, Croitoru K, Jordana M, Xing Z: Compartmentalized transgene expression of granulocyte-macrophage colony-stimulating...

Ngày tải lên: 14/08/2014, 19:22

... the New Visby program of the Swedish Institute, CompuVac grant #LSHB-CT-2004-005246 and the Russian Foundation for Basic Research #08-04- 011 07-a 17 18 19 References 10 11 12 13 14 15 16 Lauer GM, ... 10 0 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 dovirus-based vector expressing severe acute respiratory syndrome coronavirus (SARS-CoV) S protein results in the production of high levels of SARS-CoV-neutralizing ... amino acids 1 18 , 1 20, 23–43, 34–42, 13 3 14 2 and a control peptide TTAVPWNAS from gp 41 of HIV -1 were purchased from Thermo Electron GmbH (Germany) Core proteins representing aa 1 15 2 of HCV 274933RU...

Ngày tải lên: 14/08/2014, 19:22

... 51 57 60 68 74 74 83 96 10 1 10 2 11 1 11 9 12 6 12 9 CHAPTER IV DISCUSSION 4 .1 Nanog target genes as candidate regulators of the self-renewal and pluripotency of ES cells 4 .1. 1 Esrrb is a nuclear receptor ... perturbation 1. 3.2 Genomic approaches to study gene expression in ES cells 1. 4 Objective and value of this project 3 12 13 13 14 16 18 20 20 21 25 26 29 33 33 36 39 CHAPTER II MATERIALS AND METHODS 2 .1 ... genes 4.4 The regulation of the ES cell chromatin structures by Esrrb 4.5 Regulation of the reprogramming circuitry by Esrrb CHAPTER V CONCLUSION 13 3 13 6 13 9 14 2 14 4 14 7 15 1 BIBLIOGRAPHY APPENDICES...

Ngày tải lên: 12/09/2015, 08:19

... involved in suppression of FEBS Journal 278 (2 011 ) 29 01 2 912 ª 2 011 The Authors Journal compilation ª 2 011 FEBS T Ueno and K Fujimori 10 11 12 13 14 15 16 17 18 19 20 3T3-L1 adipocyte differentiation ... CRE (–224) ( 13 5) (–59) A –500 +1 +12 4 * * –500/ +12 4 * * –300/ +12 4 * * * 14 0/ +12 4 * * * 11 0/ +12 4 * * * * * –50/ +12 4 –500/ +12 4 (mu) Vehicle Fluprostenol Fluprostenol + AL8 810 pGL4 .10 WT mu Relative ... )500 ⁄ +12 4 construct FEBS Journal 278 (2 011 ) 29 01 2 912 ª 2 011 The Authors Journal compilation ª 2 011 FEBS T Ueno and K Fujimori Suppression of adipogenesis via FP-ERK-CREB-COX-2 A 0. 01 COX-2...

Ngày tải lên: 28/03/2014, 22:20

... dimethyl -1, 2,4,5-tetrazine-3,6- O C N NHC14H17N2O2S N HN N SO2N2C14H17HN O C N NHC14H17N2O2S N HN N SO2N2C14H17HN C O C O CO N H2N OC O C OC N H N N SO2N2C14H17HN O C N NHC14H17N2O2S N HN N SO2N2C14H17HN ... discussed by Kummerer [33] and in the strongly growing field of the theranostics [34] Conflict of Interest The authors have declared that no conflict of interest exists References 10 11 12 13 14 15 16 ... H N O C OC NHC14H17N2O2S NH N N N H N N SO2N2C14H17HN OC O C O C N H N CO2H NHC14H17N2O2S NH N C O 14 Figure elucidates the product of 14 after the complete DARinv-based ligation of the penta-amide...

Ngày tải lên: 25/10/2012, 11:00

... R1, R3 and R5 effluents using API ZYM kit at h, 14 h and 31 h, respectively (figure 2) 17 5.4 A 13 1.6 87.7 43.8 21. 9 17 5.4 B Enzymatic activity (nmole (ml h) -1) 13 1.6 87.7 43.8 5 21. 9 17 5.4 C 13 1.6 ... enhance phosphorus removal Wat Res Vol 21, No 11 , 13 07 -13 10 McKellar R C (19 86) Determination of the extracellular and cell-associated hydrolase profiles of Pseudomonas fluorescens Sp Using the ... (Protein, mg l -1) Effluent (Protein, mg l -1) Removed (%) 14 24 31 38 67.5 67.5 67.5 63.7 63.7 87 57.5 37 55 39.4 48 14 .8 45.2 13 .6 38 .1 44.8 65 75 75 75 75 75 47.5 48.7 52.5 31 22 26.9 35 .1 30 58.7...

Ngày tải lên: 05/09/2013, 09:08