dorsal synovial tendon sheaths at the wrist anatomy of a finger
báo cáo khoa học: "An attempt to modify allelic frequencies at the Adh locus of a Drosophila melanogaster population in a tropical environment" pot
Ngày tải lên :
09/08/2014, 22:23
... release, a sample of native flies was taken to determine the allelic frequencies in the natural population Another sample was taken at the end of release During the following weeks, new bananas ... 588-590 adaptation OUIS -L CHEEMAECKER C., DE S M., 1977 Genetic latitudinal adaptation of Drosophila melanogaster : new discriminative biometrical traits between European and equatorial African populations ... by a rare biochemical allele was released in a small, isolated natural population in tropical Africa Surprisingly, only a slight, short-term modification was observed ; the significance of the...
- 6
- 251
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
Ngày tải lên :
26/10/2012, 09:39
... the formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) ... Irvine, CA), and the intensity of the bands was determined using Kodak Digital Science 1D 2.0 imaging software Statistical Analysis Data are presented as mean ± SD Data of multiple groups were analyzed ... and endothelium and resulted in the formation of atherosclerosis (9) Javid et al also found that in the early stage of atherosclerosis, the number of Cx43 gap junction plaques increased and the...
- 8
- 467
- 0
LECTURE SLIDES ON NONLINEAR PROGRAMMING BASED ON LECTURES GIVEN AT THE MASSACHUSETTS INSTITUTE OF TECHNOLOGY CAMBRIDGE, MASS DIMITRI P. BERTSEKAS
Ngày tải lên :
26/10/2013, 17:15
... models • Data analysis and least squares formulations • Modeling human or organizational behavior CHARACTERIZATION PROBLEM • Unconstrained problems − Zero 1st order variation along all directions ... is a nonlinear programming problem • Linear and nonlinear programming have traditionally been treated separately Their methodologies have gradually come closer TWO MAIN ISSUES • Characterization ... Quadratic Approximation of f at x1 Slow convergence of steepest descent Fast convergence of Newton’s method w/ αk = Given xk , the method obtains xk+1 as the minimum of a quadratic approximation...
- 202
- 337
- 0
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
Ngày tải lên :
24/01/2014, 20:20
... to PageRank, again see [Page 98] Another intuitive justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and ... with the docID that the anchor points to It also generates a database of links which are pairs of docIDs The links database is used to compute PageRanks for all the documents The sorter takes the ... data it stores At current disk prices this makes the repository a relatively cheap source of useful data More importantly, the total of all the data used by the search engine requires a comparable...
- 20
- 571
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
Ngày tải lên :
20/02/2014, 23:20
... and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic ... mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were ... by addition of 14Clabelled pyruvate (1 lCi, about 60 nmol) after the assay mix had been incubated for 10 at 25 °C PDH assay This measures the rate of formation of NADH at 340 nm and 30 °C after...
- 10
- 459
- 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc
Ngày tải lên :
21/02/2014, 09:20
... outlined above Along the way, we are able to acquaint the reader with the culture of mathematics: who mathematicians are, what they care about, and what they We also give indications of why mathematics ... proof of any given result A proof is part of a situational ethic Situations change, mathematical values and standards develop and evolve, and thus the very way that we mathematics will alter and ... generations It is not the way that we discover mathematics Today there is a remarkable mathematics journal called Experimental Mathematics This journal—in a constructive way—flies in the face of mathematical...
- 334
- 515
- 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc
Ngày tải lên :
06/03/2014, 00:20
... related to partial catalytic activation following (Mg)ATP binding at physiological concentrations of Glc Similar or possibly larger effects of ATP in promoting a catalytically competent state may ... Molnes et al ATP binding at active site of human glucokinase Table The kinetic constants for WT GST–hGK at high and low concentrations of the fixed substrate The catalytic activity was measured at 37 ... nm at a constant heating rate of 40 °CÆh)1 The midpoint of the transition (Tm) was determined from the first derivative of the smoothed denaturation curve The associated high-voltage (pseudoabsorbance)...
- 15
- 374
- 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
Ngày tải lên :
07/03/2014, 11:20
... GCCAACACGATTTTCCTCCCAGTTGGAACGGCC GCCAACACGATTTTCAGCCCAGTTGGAACGGCC GCCAACACGATTTTCCGCCCAGTTGGAACGGCCv CCCTTCGCGCCCAACGCACTTACCCAAGGACCG CCCTTCGCGCCCAACGCAAGTACCCAAGGACCG CCCTTCGCGCCCAACGCACGCACCCAAGGACCG ... GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC ... eryngii is a monomeric glycoprotein of 70 kDa with dissociable flavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic and aliphatic polyunsaturated alcohols...
- 11
- 471
- 0
Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot
Ngày tải lên :
07/03/2014, 16:20
... Maezono K, Osman A, Pendergrass M, Patti ME, Pratipanawatr T, DeFronzo RA, Kahn CR & Mandarino LJ (2000) Insulin resistance differentially affects the PI 3-kinase and MAP kinase-mediated signaling ... recovery We therefore exclude insulin as causing the basal activation of MAP-kinases; especially as we found that a substantial degree of phosphorylation of the insulin receptor and IRS1 was required ... abdominal fat were obtained from patients at the University Hospital of Linkoping Pieces of ¨ adipose tissue were excised during elective abdominal surgery and general anaesthesia at the beginning of...
- 11
- 472
- 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
Ngày tải lên :
16/03/2014, 01:20
... [16], as are the calculations of Galabov et al concerning the energetics of the alkaline hydrolysis of N-phenylacetamides [19] The investigation of Perakyla et al on the catalytic reaction of AGA, ... substrate, and the phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active ... distribution of the real substrates and PGA active site In order to interpret the biphasic character of the Hammett plots available for AGA and GGT, it was suggested that the breakdown of the tetrahedral...
- 10
- 425
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
- 14
- 390
- 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
Ngày tải lên :
17/03/2014, 09:20
... L-Phe at half-maximum saturation ([S]0.5) of 98 lM (Fig 2A, B) Saturation was reached at approximately mM with a DRU-value of 75 RU/(pmol subunitặmm)2) Simultaneous injection of L-Phe (variable ... conformational states include a ground state for the ligand-free enzyme, an activated state with bound substrate (L-Phe), an inhibited state with bound H4biopterin and nally the state of catalytic ... that the rate of phosphorylation is indeed dependent on the extent of deamidation of a very labile Asn residue (Asn32) in the N-terminal autoregulatory sequence of wt-hPAH [34] Dopamine has a...
- 10
- 470
- 0
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt
Ngày tải lên :
22/03/2014, 14:20
... illustrations of the general nature of a candle that I can possibly give The fuel provided, the means of bringing that fuel to the place of chemical action, the regular and gradual supply of air ... here a substance which is rather porous a column of salt and I will pour into the plate at the bottom, not water, as it appears, but a saturated solution of salt which cannot absorb more; so that ... source of heat, and I am about to shew you what that vapour is Here is some wax in a glass flask, and I am going to make it hot, as the inside of that candle-flame is hot, and the matter about the...
- 164
- 271
- 0
Anatomy of a Health Scare: Education, Income and the MMR Controversy in the UK doc
Ngày tải lên :
22/03/2014, 14:20
... qualifications is associated with a lower decline in uptake However that the authors measure the educational attainment of the economically active population rather than that of the adult population ... deprivation and education and estimate that between these two years, areas with a greater share of the population with no qualifications experienced less of a decrease in the MMR vaccination rate ... thousand babies, and the average age among adults living in the area (as a proxy for the demand for health care).16 The first column of Table shows the mean across all areas and years and the standard...
- 58
- 521
- 0
Acne Symposium at the World Congress of Dermatology Pari doc
Ngày tải lên :
23/03/2014, 01:20
... including vasodilatation, increased blood flow, plasma extravasations, mast cell degranulation, the wheal and flare reaction via axon reflex, neutrophil and macrophage activation, modulation of the ... administration in 10 patients with inflammatory acne Clinical evaluation of these patients indicated an approximately 60% decrease in the acne severity index within weeks of the initiation of treatment ... inflammatory lesions Thus, the results of this small-scale clinical trial and associated laboratory analysis strongly support the conclusion that appropriate anti-inflammatory therapy has the...
- 75
- 177
- 0
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt
Ngày tải lên :
23/03/2014, 21:20
... GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC Table Micro-organisms and plasmids ... strand of the ribA Designation Primer orientation MF BamH1rev P-C54S-f P-C54S-r P-C65S-f P-C65S-r P-C67S-f P-C67S-r + – + – + – + – Sequence ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG ... in the light of the rapid progression of resistance development in all microbial pathogens In contrast with the riboflavin biosynthetic pathway, the dihydrofolate pathway was already validated as...
- 7
- 367
- 0
Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot
Ngày tải lên :
28/03/2014, 23:20
... Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a Surinam ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... sistemas no dan abasto debido al SIDA y a la mortalidad asociada esta enfermedad En última instancia, aunque las causas de la mortalidad materna y de las lesiones y discapacidades relacionadas el...
- 48
- 417
- 0
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx
Ngày tải lên :
30/03/2014, 20:20
... preparations this ratio was rate constant, ks: always below the critical value of 1.33 at which the transition between the extended bilayer sheet and the micelle takes place Each of the above ... significant variation in the diameter of the liposomes with varying lipid/detergent molar ratio Due to dispersion of the data for the same sample we conclude that an average value of 110 ± 25 nm can ... chromatophores, where quinone can freely diffuse towards and away from the enzyme, and the large volume of the bilayer allows the accommodation a large number of ligands; (b) the arrangement of the...
- 11
- 365
- 0
the broadband problem anatomy of a market failure and a policy dilemma
Ngày tải lên :
03/06/2014, 00:55
... performance of the ILECs has been by far the worst of any major information technology sector Furthermore, their strategic, managerial, and political conduct have greatly affected the nature and ... is exacerbated by the fact that for several reasons—learning effects, the importance of network externalities related to standardization and compatibility, and conventional scale economies—mature ... realize the largest potential gains in these areas, particularly in videoconferencing Broadband issues also have significant national security implications for the United States In the wake of the...
- 253
- 405
- 0