don apos t stop short in the search for causes
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf
... identification of the core of the protein in the N state and the evolution of the overall structure of the protein in the MG state This degree of resolution is unprecedented for the T domain of the ... aggregate at high concentrations, etc In the case of the T domain, the MG state corresponds to the functional state, which initiates the translocation of the catalytic domain Here, the data allowed ... state) the protection of TH5 is a result of dimer formation, the dimer may be still present in the MG state The most protected region of the protein in the MG state is TH9 (Fig 5B) Indeed, after...
- 10
- 530
- 0
beyond rationality the search for wisdom in a troubled time jan 2007
... but blinded to what? We say that they don t understand the times they live in, or that they are resisting something called the logic of the facts,” or “trying to put the clock back,” or that ... it might even be dangerous for all concerned The myth that attracted Berlin was the myth of the “great man,” the same myth that attracts the less fortunate: that the road to peace, justice, and ... alternatives presented to it and the character of the information available to it.4 Thus, we address the problem of uncertainty in the environment, for it is that uncertainty that forces us to...
- 363
- 189
- 0
Báo cáo y học: " HIV-1 infection and CD4 T cell depletion in the humanized Rag2-/-γc-/- (RAG-hu) mouse model" docx
... will be the next step to exploit this system for vaccine/immunity studies Substantiating the potential for immune response to other antigens, recent results from our laboratory demonstrated Dengue ... observed in both mice infected with the R5-tropic strain BaL, similar to the results seen in SCID-hu-PBL mice (Fig 6D) [35] The continued CD4 T cell depletion through at least weeks indicates that R5-tropic ... depletion to below 50% of normal at weeks postinfection To further investigate CD4 T cell depletion at the infected tissue level, thymus from an uninfected control and infected mouse (same tissues...
- 14
- 216
- 0
The search for stem cell in human breast milk
... with the mammary epithelial cells within the gland attaining their unique ability to synthesise various milk components At the last stages of gestation, the distal portion of the mammary ducts ... Effects on infant There have been several studies reporting on the benefits of breast milk for the infant These studies have reported a benefit of breastfeeding with respect to the reduction in the ... compensate for the developmental delay of the infant (Goldman et al 1998) Maternal lymphocytes in HBM have been shown to enter the circulation of the offsprings, presenting themselves in the intestinal...
- 221
- 362
- 0
The search for growth opportunities and risks for institutional investors in 2012
... whether they’ll get it right.” In the wake of the 2008 crisis these institutions have repeatedly intervened to shore up liquidity in key markets while attempting to manage a soft landing in China ... Economist Intelligence Unit forecast attach a high probability to government debt ratios increasing In the US, the ratio of public debt to GDP is forecast by the Economist Intelligence Unit to EIU ... recovery—at least in the short term © The Economist Intelligence Unit Limited 2012 The Search for Growth Opportunities and risks for institutional investors in 2012 Survey respondents overwhelmingly...
- 34
- 212
- 0
Học tiếng Anh qua bài hát: Don''t Let Me Down - The Chainsmokers ft. Daya
... right now Vâng, em r t cần anh So don' t let me, don' t let me, don' t let me down Vì vậy, đừng có mà bỏ rơi em, đừng bỏ em I think I'm losing my mind now T m trí em rối bời It's in my head, darling ... need you the most Hãy bên em em cần anh So don' t let me, don' t let me, don' t let me down Đừng nói lời chia tay, đừng rời xa em Don' t let me down Đừng làm em rơi xuống vực thẳm Yeah, don' t let me ... the most Anh bên em em cần anh So don' t let me, don' t let me, don' t let me down Vì vậy, đừng bỏ em, đừng xa em, đừng để em D -Don' t let me down Đừng rời xa em Don' t let me down Đừng bỏ em mà Don' t...
- 5
- 880
- 0
A STUDY ON THE ENGLISH VIETNAMESE TRANSLATION OF TERMS IN THE MATERIALS FOR MECHANICAL ENGINEERING
... technical translation, so it plays an important role in the development of Mechanical Engineering The thesis studies the English – Vietnamese translation of terms in the materials for Mechanical Engineering ... out appropriate Vietnamese equivalents for the English terms The thesis aims to draw out common translation strategies which can be applied in the English-Vietnamese translation of terms in materials ... Engineering First, the thesis collects and groups English Mechanical Engineering terms and Vietnamese ones Next, the thesis works out and compares the English terms with the Vietnamese ones to finds...
- 2
- 855
- 9
A STUDY ON THE ENGLISH VIETNAMESE TRANSLATION OF TERMS IN THE MATERIALS FOR MECHANICAL ENGINEERING
... meaning of the original within the constraints of the TL grammatical structures” and “it attempts to be completely faithful to the intentions and the text-realization of the SL writer” (Newmark, ... important contribution to the development of translation Newmark states (1988a:7) “translation is a craft consisting in the attempt to replace a written message and statement in one language by the ... matter without the manner, the content without the form of the original It is usually a paraphrase much longer than the original, a so-called “intralingual translation” Idiomatic translation In...
- 43
- 1,061
- 2
Tài liệu THE SEARCH FOR OBJECTIVE MEASURES OF AESTHETIC JUDGMENT: THE CASE OF MEMORY TRACES docx
... variable in the present study, might also influence how memory traces are related with aesthetic judgments The following statement summarizes the main hypothesis we set out to test: The stimuli that ... main differences in the rating trends between both groups of participants appear in the interesting dimension When participants without art education rated the interest of artistic stimuli they ... raised by the results in the interesting dimension for which the relationship is different in both groups When rating the interest of artistic stimuli, subjects without art education followed the general...
- 12
- 474
- 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt
... Oligonucleotide Sequence (5Â- to 3Â) Restriction site -SpsB5 -SpsB3 tr-SpsB5 pIsaA5 IsaA3Myc TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC TAGAATTCTTAATTTTTAGTATTTTCAGG TACATATGCACCATCACCATCACCATATTGTTACACCATATA ... of the amino acids immediately preceding the catalytic serine form a part of the substrate-binding pocket They might also contribute to the correct folding and conformation of the enzyme In conclusion, ... study the effect of pH on the enzyme The stability of the synthetic SceD peptide substrate was determined by incubating it in different buffers in the absence of the enzyme No increase in uorescence...
- 13
- 464
- 0
No Safer Place in the World for Your Money - How to Make Sure All Your Deposits Are Protected by FDIC Insurance docx
... access to accounts on the next business day by arranging with a healthy institution to assume the insured deposits The account owners can then decide whether to remain as customers of the other ... U.S Savings Bond on their tax return, without having to open an account at the U.S Treasury Department or take other action The change will give taxpayers another easy way to save their tax refunds ... United States government.” This is important It means that the financial resources of the U.S government protect federally insured depositors — and you can t better than that In short, ” said...
- 8
- 725
- 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... coupling constant [32,33] Determining the absolute configuration of the talosyl residue in the GDP-6-deoxytalose by GC/MS Based on the coupling constants in the 1H NMR spectra, we determined that the ... proteins The peak that appeared at 24.0 was in agreement with that of authentic NADP+ The reason why the NADP+ peak appeared in the gmd gene product reaction has been unidentified The retention time ... [20] The GC contents of the genes essential for SPA biosynthesis in A actinomycetemcomitans SUNYaB 75 are lower than the average GC content (47.8%) of the genes flanking them The GC contents of...
- 9
- 625
- 0
Perfect symmetry the search for the beginning of time h pagels
... perfect symmetry than absolute nothingness? For the first time in history, scientists have constructed mathematical models that account for the very creation of the universe out of nothing There ... convective currents of hot matter, holds the key to a star's life Not only the nuclear reactions in the core provide the heat that prolongs the life of the star, but in the later stages of the ... at the size of the universe once they pause to reflect upon the meaning of the distances they are calculating In spite of their vast numbers, stars not begin to crowd each other because of the...
- 460
- 278
- 0
The Heart of Grief Death and the Search for Lasting Love pptx
... share them here with you We can identify with the longing for lasting love in these stories With the suffering that bereavement brings With the anxiety about whether we can find lasting love for ... water We are then told that those who have died "have never left" and that they are "not under the earth." Rather, they are in the rustling trees, the groaning woods, the crying grass, and the ... it hurts, and find effective ways to come to terms with that hurt It is simply not true that "Everyone needs to talk about their feelings." It matters less how we these things than that we find...
- 310
- 871
- 0
does sexual harassment still exist in the military for women
... and the Philippines The Vietnam vets and the exploitativesexual attitudes they developed in Asia arrived home in the 70's just as women were beginning to move into the ranks This resulted in ... percent in a 1988 survey of all the services to 55 percent, according to the report The unreleased documents indicated that amoung the individual services, the Navy improved the most over that period ... a lot of cases and re-occurring problems for it to finally get the notice itneeds "Basis trainees are learning that at all levels, the word is getting out that discrimination and harassment have...
- 3
- 225
- 0
nuallain - the search for mind - a new foundation for cognitive science (cromwell, 2002)
... Meaning in this sense is therefore tied in with intent and we should not find it any easier to formalize than the latter; any major criminal trial which attempts to intuit the precise “intent” ... undergraduate and postgraduate For the reader’s information, it should be stated that Sections 3.3 and 3.7 in this book can be passed safely by the reader without losing any continuity in the point the ... better start, as we’ve a lot to get through To make things easier, we’ll ignore Oriental thought for the moment The content of this section, then, is those schools of thought which originated in...
- 288
- 258
- 0
the search for antarctic dinosaurs
... snowstorms made it too dangerous to f ly The crew had to wait at base camp until the weather improved Getting to the site was only half the problem Collecting the fossils was the other half The ... pants They also needed two jackets One was a lightweight jacket The other was a thick one 16 The scientists got special boots too The boots had a layer of air inside them The air helped keep their ... least two other dinosaurs They found the teeth with the bones of Cryolophosaurus Some of its bones had tooth marks on them Hammer thinks that after Cryolophosaurus died, other meat-eating dinosaurs...
- 50
- 263
- 0
pharmacogenomics the search for individualized therapies
... Abstract 143 Introduction 143 The Need for Protein Structure Information 144 Protein Structure and Variation in Drug Targets the Scale of the Problem 145 Mutations in Drug Targets Leading to ... its distinction from pharmacogenetics Rather than edit out those at times conflicting and redundant paragraphs we thought it would be in the readers best interest to leave those in, so that ... co-exist with their eukaryotic host; in the human this includes the concept of the microbiome [14], which is defined as the totality of microbial organisms that co-habit with human beings On the other...
- 585
- 261
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25