... Weather report It’s sunny It’s cloudy rainny It’s ...
Ngày tải lên: 06/09/2013, 13:10
... Tetrahymena Proc Natl Acad Sci USA 96, 14 967 14 972 11 Rasio D, Schichman SA, Negrini M, Canaani E & Croce CM (19 96) Complete exon structure of the ALL1 gene Cancer Res 56, 1 766 1 769 12 Nakamura ... activation [ 31 ] Domain mapping experiments localize B C MLL1-TAD domain E 665 E 666 K2 91 E 666 R294 1 DNA Binding Surface Extended loop MLL1 CXXC domain K2 91 3 E 665 C-Myb 3 α2 R294 α2 1 C-Myb ... role of WDR5 in binding histone H3, at least while WDR5 is incorporated into the MLL1 core Cleavage site BD FYRN TAD FYRC Win SET 1- -3 969 Win motif V3 768 A3 766 90° E3 767 G3 762 S3 7 63 R3 765 L3770...
Ngày tải lên: 16/02/2014, 14:20
Báo cáo y học: "Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" potx
... 5'-ATGGCAACCCTGTCCCTGAG -3' and LG 011 7 5'-GGAAACCCAACCACGCTGTA -3' ) and Page of (page number not for citation purposes) Virology Journal 2009, 6: 86 (LG 011 9: 5'-GCTAACTCTAATGCTGCCACC -3' and LG 01 36 : ... using partial sequence fragments Sequence Fragment Klasse-stl1 Klasse-bar1 Klasse-mel1 Klasse-stl1 3D 10 0% 97% 96% Klasse-slt1 2C 10 0% 87% 10 0% 91% 96% Klasse-bar1 3D 10 0% 97% Klasse-bar1 2C 10 0% ... for citation purposes) Virology Journal 2009, 6: 86 30 31 32 33 34 35 36 http://www.virologyj.com/content /6/ 1/ 86 PCR as an index of human viruses Appl Environ Microbiol 19 98, 64 :33 76- 33 82 Lodder...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx
... 5'-ATGGCAACCCTGTCCCTGAG -3' and LG 011 7 5'-GGAAACCCAACCACGCTGTA -3' ) and Page of (page number not for citation purposes) Virology Journal 2009, 6: 86 (LG 011 9: 5'-GCTAACTCTAATGCTGCCACC -3' and LG 01 36 : ... using partial sequence fragments Sequence Fragment Klasse-stl1 Klasse-bar1 Klasse-mel1 Klasse-stl1 3D 10 0% 97% 96% Klasse-slt1 2C 10 0% 87% 10 0% 91% 96% Klasse-bar1 3D 10 0% 97% Klasse-bar1 2C 10 0% ... for citation purposes) Virology Journal 2009, 6: 86 30 31 32 33 34 35 36 http://www.virologyj.com/content /6/ 1/ 86 PCR as an index of human viruses Appl Environ Microbiol 19 98, 64 :33 76- 33 82 Lodder...
Ngày tải lên: 12/08/2014, 04:22
NGHIÊN CỨU ẢNH HƯỞNG CỦA PHÂN BÓN NPK (3-6-1) ĐẾN SINH TRƯỞNG CỦA LÁT HOA (Chukrasia tabularis A.Juss) GIAI ĐOẠN 1 - 3 THÁNG TUỔI TẠI VƯỜN ƯƠM CƠ SỞ 3 TRƯỜNG ĐẠI HỌC HỒNG ĐỨC
... 40.75 37 .75 37 .75 37 .75 37 .75 χ n tính toán 0.0 217 39 2 . 63 0 435 4.8 9 13 04 15 .847 83 2.09 969 3 0.07 515 3 5 .33 8957 1. 289877 2.02 81 46 1. 39 238 4 13 .11 424 11 .40 5 63 60 . 13 538 χ2n tra bảng 12 .6 Qua bảng (3 .15 ) ... 2 010 8,4 8 .6 73 15 ,1 3, 9 7,5 26, 1 45 ,6 16 , 7 85,9 44,7 97,2 34 ,5 31 , 7 18 8,4 10 9,7 79,8 11 1 ,6 272,7 248 ,3 14 5,2 15 7 ,6 688,7 34 9 ,6 502,8 34 7 ,6 34 8 232 ,9 4 71, 9 1 06, 6 16 , 6 10 ,6 18 ,6 8,9 53 ,1 Nhiệt độ ... 06- 07/05/2 011 H D L 49 17 3 ,66 2 1, 27 2,459 31 51 7,45 1, 78 7,08 29 40 11 49 12 3, 5 83 1, 3 26 2,7 93 45 41 8,74 2,02 8,45 45 39 46 3, 76 1, 37 3 ,1 06 60 25 9,72 2, 23 9, 86 60 26 52 20 3, 049 1, 512 1, 8 63 ...
Ngày tải lên: 31/10/2012, 10:20
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
... function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3. 0 - Lab 3 .1. 1 Copyright 20 03, Cisco ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc
... function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3. 0 - Lab 3 .1. 1 Copyright 20 03, Cisco ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx
... 10 0- 23 Orange 66 31 100-27 Purple 66 31 100-28 Blue 66 31 100-29 Green 66 31 100 -30 Type 16 0 Hinged For examples of TIA/EIA color-coding, refer to the chart on page 17 0 Tech Tip Labeling templates are ... 3 .69 " ( 468 .0mm x 12 3. 8mm x 93. 7mm) 66 37 18 0 -60 30 0-pair preterminated to (12 ) 25-pair female telco (RJ-21X) connectors 27 . 13 " x 4.88" x 3 .69 " (68 9.0mm x 12 3. 8mm x 93. 7mm) 66 37 210 -60 • 10 2094AE TrueNet® ... Blue and white One side is blue and marked in 4-pair increments; other side is white and marked in 5-pair increments Front (Blue) 66 31 100- 26 Back (White) Gray/brown 66 31 100-22 Yellow/red 66 31 100-23...
Ngày tải lên: 24/01/2014, 11:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin 16 0 ; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )1 06 to ) 86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin 16 1 , 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG ... 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG -3 , corresponding to NTs )14 0 to )11 8) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ATCTTCTC -3 , corresponding to NTs )11 9 ... GTGGATCCTGATCCCTCAGGGCTC -3 ; sense primer) vs its complement generating pGL3b:Prm3AP )1* , pGL3e: Prm3AP )1* , pGL3b: Prm3aAP )1* , pGL3e:Prm3aAP )1* , pGL3b:Prm3abAP )1* , pGL3e: Prm3abAP )1* , pGL3b: Prm3aaAP )1* ,...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... ATCTTCCAGgtaacaac 62 5 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 8 51 CTTCTCCCGgtgtgcac 4 03 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ... 95, 10 82 10 90 Ray A, Shakya A & Ray BK (2005) Inflammationresponsive transcription factors SAF -1 and c-Jun/c-Fos promote canine MMP -1 gene expression Biochim Biophys Acta 17 32 , 53 61 10 Ray A, Bal ... Biochemistry 36 , 466 2– 466 8 15 Ray BK, Chatterjee S & Ray A (19 99) Mechanism of minimally modified LDL-mediated induction of serum amyloid A gene in monocyte/macrophage cells DNA Cell Biol 18 , 65 – 73 16 Ray...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx
... sn : n 1 sn = sn−2 + 3n 1 + 36 ; sn = sn−2 + 3n 1 + 31 , n n 0 sn = sn−2 + 3n 1 + 3n ; sn = sn−2 + 3n 1 + 31 , n sn = sn−2 + 3n 1 + 36 ; sn = sn−2 + 3n 1 + 31 , or n n sn = sn−2 + 3n 1 + 30 ; sn ... it is not the case, sn = sn 1 + 30 = sn 1 + 36 , then n n sn +1 = sn 1 + 0 6 + n +1 = sn 1 + n + n +1 = sn 1 + n + n +1 , 3n 3 3 which implies sn 1 − sn 1 = sn 1 − sn 1 = 3n 1 a contradiction to Consequence ... (0, 6, 0, 1, 1, , 1, 0, 6, 0, 6, 0, 1, 1, , 1, ) k1 =3 k2 k3 =5 ( 16 ) k3 Note that, for i ∈ Oj , from (12 ), # ski ⎧ √ ⎨> +3 ki +3 ki2 (a1 = − a2 ) = ⎩ < For s ∈ supp µ is defined ( 16 ) and...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... were as follows: Phe51Ala mutation, 5¢-CGGAACCCCGCAGGTCGAGTTTCC -3 and 5¢-GA CGAGGTGCTCGGGGCTCTT -3 ; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC -3 and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG -3 The ... a- helix H¢¢ 3 (residues 18 8 12 2) A large difference is centred on Met1 21 In particular, the mean B-factors of Met1 21 at ˚ ˚ the A and B chains are 26. 67 A2 and 49. 26 A2 , and the ˚ and 79 .30 A2 , ... Acta 460 , 15 1– 16 1 Zall, D.M., Fisher, D & Garner, M.Q (19 56) Photometric determination of chlorides in water Anal Chem 28, 16 6 5– 16 6 8 Hu, L & Colman, R.F (19 95) Monobromobimane as an a nity label...
Ngày tải lên: 16/03/2014, 16:20
Chronicles (3 of 6): Historie of England (1 of 9) Henrie IV ppt
... capteine Dauid duke of Rothsaie, and a prince of the realme, with Archembald earle of Dowglas, [Sidenote: The duke of Albanie.] hauing with them manie hardie men of warre Robert duke of Albanie, that ... earle of Salisburie (saith Thomas Walsingham) who in all his life time had béene a fauourer of the Lollards or Wickleuists, a despiser of images, a contemner of canons, and a scorner of the sacraments, ... Thomas Beauchampe earle of Warwike In the moneth of March appeared a blasing starre, first betwéene the east part of the firmament and the North, flashing foorth fire and flames round about it, and...
Ngày tải lên: 24/03/2014, 00:20
Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx
... VWPLVIRTVIAGYNLYRAIKKK RVKRVWPLVIRTVIALYNLYRAIKKK RVKRVWKLVIRLVKALYKLYRAIKKK +8 +4 +5 +5 +5 +8 +11 26 15 23 19 22 26 26 31 4 1.9 18 07 .3 2758.4 2220.8 260 3. 2 31 9 9.0 32 71. 2 31 4 1 .6 18 07 .6 2757.2 2220.9 260 0 .3 ... Fowl -1 (1 23) Fowl -1 (8– 26) Fowl -1 (5– 26) Fowl -1- L 16 Fowl -1- KLKLK 0.5 13 .8 1. 1 2.8 0 .6 2.0 1. 9 2.0 13 .8 2 .3 5 .6 2.4 3. 9 > 7 .6 2.0 3. 5 2 .3 2.8 2.4 2.0 1. 9 4.0 6. 9 4.5 5 .6 4.8 7.8 > 7 .6 > 4 43 38 > 36 0 ... Energies (kcalÆmol )1) Overall 31 . 76 ± 1. 24 Bonds 1. 46 ± 0 .12 Angles 18 . 61 ± 0 .39 Improper 1. 09 ± 0 . 13 van der Waals 5 .30 ± 0. 96 NOE 5 .30 ± 0 . 63 ˚ Pairwise RMSDs for residues 1 26 (A) Backbone 2.98...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx
... 46. 61 50 1. 10 95 31 8 10 .2 (37 .7) 10 .4 (2 .1) 10 1. 10 0 . 13 0 .17 2 06 57.80 85.59 46. 46 50 1. 30 55 009 7.9 (33 .0) 14 .4 (3. 2) 10 1. 30 0 .12 0. 16 2 23. 5 59.45 87.00 46. 32 50 1 .60 32 005 9 .1 ( 41. 3) 13 .2 ... 0. 033 0. 0 13 0. 030 0.009 0.029 0. 011 0.0 31 0. 010 0. 030 0. 012 0. 034 15 .9 21. 9 27.5 31 . 5 8.0 12 .2 14 .0 23. 7 9.0 13 .7 10 .6 24.4 10 .6 15 .4 14 .7 25.8 22.4 27 .6 29.9 37 .9 16 . 7 21. 1 19 .1 30 .9 14 .2 18 .4 18 .3 ... 13 .2 (3. 7) 10 1 .60 0 .15 0. 23 15 5 58.88 86. 27 46. 40 50 1. 42 40 847 9.8 (70.8) 17 .1 (2 .6) 10 1. 42 0 .18 0. 23 19 9 58. 91 86. 07 46. 54 50 1. 38 47 418 10 .4 (28 .6) 14 .1 ( 13 .8) 10 1. 38 0. 16 0. 21 190 58.46...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: ˚ Crystal structure at 3 A of mistletoe lectin I, a dimeric type-II ribosome-inactivating protein, complexed with galactose pdf
... Biol 33 , 4 91 497 31 Navaza, J (19 94) AMoRe: an automated package for molecular replacement Acta Crystallogr A5 0, 15 7– 16 3 32 Rutenber, E., Katzin, B.J., Ernst, S., Collins, E.J., Mlsna, D., Ready, ... Oc1 of Thr 110 of RTB Among the hydrophobic contacts, Ilel14 of MLB is mutated to an asparagine in RTB and a serine in ABB Comparison of MLI structures Two MLI structures are currently available ... with the main-chain atoms of Thr 118 , and Ser 111 , which makes water-mediated hydrogen bonds with the O of Gly32, are not conserved in RTB and ABB However, Oc of Ser 111 is located in a similar position...
Ngày tải lên: 31/03/2014, 01:20
Chronicles (1 of 6): The Historie of England (3 of 8) pot
... Olympiad, after the building of the citie of Rome 750 nigh at an end, after the vniuersall floud 2 31 1 , from the birth of Abraham 2 019 , after the departure of the Israelits out of Egypt 15 13, after ... Rome 4 51, after the deliuerance of the Israelites 2 36 , and in the tenth yeare of Cassander K of Macedonia, which hauing dispatched Olimpias the mother of Alexander the great, and gotten Roxanes ... yeare of the world 15 96, after the building of Rome 38 0, after the deliuerance of the Israelites out of captiuitie 16 4 complet, which was about the 33 yeare of Artaxerxes Mnenon, surnamed Magnus,...
Ngày tải lên: 31/03/2014, 11:20
Anh 6 Unit8 A 1.2.3
... Look at these people and talk about the actions Ride a motorbike Walk to school Ride a bike Play video game Travel by bus Wait for a train Drive a car Unit8:OUT AND ABOUT LESSON 1: A 1, 2 ,3 What are ... Match the pictures to the words: a b walk to school c wait for a train d drive a car ride a bike e f play video games travel to school by bus I am playing video games He is playing video games ... driving my car He is driving his car We are traveling We are waiting to school by bus for a train They are walking They are traveling They are waiting to school to school by bus for a train *Structure...
Ngày tải lên: 14/07/2014, 10:00
English 6-Unit7- A 1,3,5,7
... ( A1 .3. 5.7 ) A3 .) Practice with a partner: A3 .Practice with a partner: (a) What is this ? It’s a bank A3 .Practice with a partner: (a) What is this ? It’s a post office A3 .Practice with a partner: ... partner: (a) post office A3 .Practice with a partner: (a) supermarket A3 .Practice with a partner: (a) What is this ? Khách Sạn hotel A3 .Practice with a partner: (a) restaurant A3 .Practice with a partner: ... partner: (b) restaurant A3 .Practice with a partner: (b) hospital A3 .Practice with a partner: (b) trees A3 .Practice with a partner: (b) a lake A3 .Practice with a partner: (b) a mountain UNIT 7:...
Ngày tải lên: 18/07/2014, 02:00
Unit 1 : A visit of a pen pal - Period 3: READ
... table: Area: 32 9,758 Population: Over 22 million Tropical climate Climate: Unit of currency: The ringgit Capital city: Kuala Lumpur Islam Official religion: National language: Bahasa Malaysia ... 1 Ms Minh Thu PETRONAS TWIN TOWERS Ms Minh Thu Unit : A visit of a pen pal Period 3: READ Ms Minh Thu Matching Countries in Asian Capital Viet Nam Bangkok Indonesia Yangon Malaysia Jakarta ... language: Ms Minh Thu True / False statements: Malaysia is a member country of ASEAN T There are two religions in Malaysia F There are more than two religions People speak only Malay in Malaysia...
Ngày tải lên: 17/10/2014, 21:00