... optimal transform As for the coding stage, it has been shown (see, e.g., [12]) that channel codes that are able to get very close to channel capacity are good candidates for S-W coding The intuition ... Wyner-Ziv image coding technique working in the pixel domain is proposed, while in [19, 20], a scheme preventing the performance loss in scalable video coding is proposed, which performs DSC between ... deal with lossy image coding, while the subject of the present paper is lossless coding Waveletbased techniques can be easily extended to the lossless case using integer transforms and transmitting...
Ngày tải lên: 22/06/2014, 23:20
... enhanced for improved coding efficiency, including: r Small block-size transform, r Hierarchical block transform, r Short word-length transform, r Exact-match transform, r Arithmetic entropy coding, ... information loss (distortion) Further compression can be achieved by encoding the processed data using an entropy coding scheme such as Huffman coding or Arithmetic coding Image and video compression ... processes of compression (encoding) and decompression (decoding), in which bandwidth-intensive ‘raw’ digital video is reduced to a manageable size for transmission or storage, then reconstructed for display...
Ngày tải lên: 22/12/2013, 10:16
Báo cáo hóa học: " Positive solutions of the three-point boundary value problem for fractional-order differential equations with an advanced argument" ppt
... boundary value problem for a second order ordinary differential equation J Math Anal Appl 1992, 168:540-551 Jankowski T: Positive solutions for three-point one-dimensional p-Laplacian boundary value ... solution for a nonlinear fractional differential equation Bound Value Probl 2009, 18, Article ID 324561 Ahmad B, Nieto JJ: Existence results for a coupled system of nonlinear fractional differential ... solutions to singular boundary value problem for nonlinear fractional differential equation Comput Math Appl 2010, 59:1300-1309 Nieto JJ: Maximum principles for fractional differential equations derived...
Ngày tải lên: 21/06/2014, 03:20
Báo cáo hóa học: " Research Article Existence of Positive Solutions to a Boundary Value Problem for a Delayed Nonlinear Fractional Differential System " ppt
... operator such that either i Tu ≤ u for u ∈ P ∂Ω1 and Tu ≥ u for u ∈ P ∂Ω2 ii Tu ≥ u for u ∈ P ∂Ω1 and Tu ≤ u for u ∈ P ∂Ω2 or Then T has a fixed point in Ω2 \ Ω1 Boundary Value Problems Existence of ... 2 Boundary Value Problems study on systems of fractional differential equations, not much has been done for boundary value problems for systems of fractional differential ... t, s > for < t ≤ s < We only need to show that Gi t, s > for < s ≤ t < For < s ≤ t ≤ 1, let gi t, s hi t, s tαi −1 − s 1−s αi −ni αi −ni − t−s − 1− s t αi −1 αi −1 , 3.11 3.12 Boundary Value...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Nonlocal Boundary Value Problem for Impulsive Differential Equations of Fractional Order" ppt
... value problem for a nonlinear fractional differential equation,” Electronic Journal of Qualitative Theory of Differential Equations, no 3, p 11, 2008 S Zhang, “Positive solutions for boundary -value ... q M Γ q for t ∈ Ji , i M 0, 1, , p 3.6 Advances in Difference Equations 11 These imply that F1 u t ≤ B, where B is a positive constant, that is, F1 is uniformly bounded In addition, for any ... 0,∞ r/ H Kψ r 1/2 8θ 26 /3 π > 1/ − L for any given √ √ Theorem 3.1, the above problem 3.13 has at < θ < π/ 128 26 Therefore, By √ √ least one solution for < θ < π/ 128 26 References A A Kilbas,...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article Positive Solution of Singular Boundary Value Problem for a Nonlinear Fractional Differential Equation" potx
... solutions for a class of singular fractional boundary value problems,” Boundary Value Problems, vol 2009, Article ID 421310, 10 pages, 2009 11 B Ahmad and J J Nieto, “Existence results for nonlinear ... of solution for a boundary value problem of fractional order,” Acta Mathematica Scientia B, vol 26, no 2, pp 220–228, 2006 S Zhang, “Positive solutions for boundary -value problems of nonlinear ... that α D0 u t f t, u t 0, u u Namely, 1.2 holds The proof is therefore completed u 0, < t < 2.16 Boundary Value Problems Remark 2.7 For G t, s , since < α ≤ 3, ≤ s ≤ t ≤ we can obtain α−1 t 1−s α−2...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo sinh học: " Research Article Boundary Value Problems for Delay Differential Systems" ppt
... boundary value problem for system 3.1 3.8 Advances in Difference Equations 3.1 Fredholm Boundary Value Problem Using the results in 8, , it is easy to derive statements for a general boundary value ... step from the solvability condition of the boundary value problem for z1 t Advances in Difference Equations 15 For ε1 , we get the boundary value problem k z1 t ˙ A Sh0 z1 t B t Sh z0 t Bi t ψ ... solvability condition of the boundary value problem for z2 t : z2 t ˙ A Sh0 z2 t B t Sh z1 t , z2 4.37 The solvability criterion for the problem 4.37 has the form b b H s B s Sh X PQr c1 G , s1...
Ngày tải lên: 21/06/2014, 16:20
báo cáo hóa học:" Positive solutions for boundary value problem for fractional differential equation with $p$-Laplacian operator" doc
... of initial value problems for nonlinear fractional differential equations Appl Math Lett 23, 676–680 (2010) [15] Zhao, Y, Sun, S, Han, Z, Zhang, M: Positive solutions for boundary value problems ... solutions of a boundary value problem for a nonlinear fractional differential equation Electron J Qual Theory Diff Equ 3, 1–11 (2008) [17] Wang, X: Impulsive boundary value problem for nonlinear differential ... ||y|| for all y ∈ Pc Suppose that there exist a, b and d with < a < b < d ≤ c such that (C1) {y ∈ P (α, b, d)} |α(y) > b} ̸= ∅ and α(Ay) > b, (C2) ||Ay|| < a, for ||y|| ≤ a; (C3) α(Ay) > b, for...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: "Research Article Antiperiodic Boundary Value Problems for Finite Dimensional Differential Systems" pptx
... certain conditions on G, f, and function, Δu tk k Ik u for k 1, 2, , p, we prove an existence result for E 1.2 Antiperiodic Problem for Differential Equations in Rn Let | · | be the norm in ... Therefore we have u t p − λ Σi Ii ui ti T t Gu s f s ds λ G us f s ds 3.11 for t ∈ 0, t1 , and u t p − λ Σi Ii ui ti T Gu s t λ G us f s ds f s ds λ Σk Ii ui ti i 3.12 Boundary Value Problems for ... measurable in t for each x ∈ Rn , and f is continuous in x for each t ∈ 0, T , such that |f t, x | ≤ g t for t, x ∈ 0, T × Rn , where g · ∈ L2 0, T , and let Ik : Rn → Rn be continuous functions for k...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article Maximum Principles and Boundary Value Problems for First-Order Neutral Functional Differential Equations" potx
... ∈ s, ∞ , 2.8 j for the operator described by formula 1.5 , and n t i s Ss y t ki t, s y s ds, t ∈ s, ∞ , 2.9 for the operator described by formula 1.6 It is clear that ρ Ss < for every s ∈ 0, ... that is, C t, > for ≤ t < 8, C t, < for t > 8, C t, s > for < s ≤ 2, ≤ t < 4, C t, s < for < s ≤ 2, t > We see that each interval 0, ω , where ω < 8, is a nonoscillation one for this equation, ... are defined by formula 2.19 respectively The operator for t ∈ s, ∞ , B2 t As is the zero one for every s > and consequently As t 1/2 for t ∈ 2, ∞ and condition 2.31 is not fulfilled for s and S :...
Ngày tải lên: 22/06/2014, 03:20
Báo cáo hóa học: " Research Article Lossless Compression Schemes for ECG Signals Using Neural Network Predictors" doc
... that the two-stage compression schemes give better compression performance results compared to single-stage compression scheme, while the quality performance results are the same for both methods ... estimation in lossless ECG compression, ” Computer Methods and Programs in Biomedicine, vol 67, no 3, pp 177–186, 2002 [18] S D Stearns, “Arithmetic coding in lossless waveform compression, ” IEEE ... are stated in Section PROPOSED LOSSLESS DATA COMPRESSION METHOD The above lossless compression method is implemented in two different ways, single- and two-stage compression schemes In both schemes,...
Ngày tải lên: 22/06/2014, 20:20
Báo cáo hóa học: "TERMINAL VALUE PROBLEM FOR SINGULAR ORDINARY DIFFERENTIAL EQUATIONS: THEORETICAL ANALYSIS AND NUMERICAL SIMULATIONS OF GROUND STATES" pdf
... boundary value problems for higher-order linear differential equations with strong singularities, Boundary Value Problems 2006 (2006), Article ID 83910, 32 pages [2] J V Baxley, Boundary value problems ... n−1 ρ (r) ≥ 0, n r2 −1 ρ r2 = 0 < r < r2 , (3.63) for some r2 > ∗ Proof By the previous Lemma 3.3, for the given η1 , there exists a y0 such that for all pos∗ itive y0 ≤ y0 , the solution passing ... such that (3.10) is fulfilled Therefore, the result follows Lemma 3.5 There is a y1 > y0 such that for any solution ρ = ρ(r) with n r1 −1 ρ r1 = y1 ρ r1 = 0, (3.64) for some r1 > 0, there exist
Ngày tải lên: 22/06/2014, 22:20
ON A PERIODIC BOUNDARY VALUE PROBLEM FOR SECOND-ORDER LINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS S. pptx
... 2t u0 (t) = ν1 − µ2 y(t) t −1 µ1 for ≤ t ≤ µ1 for µ1 < t < µ2 for µ2 ≤ t ≤ ν1 (2.6) for ν1 < t < ν2 for ν2 ≤ t ≤ Obviously, u0 ∈ C ([0,ω]) Now let A = {µ1 ,ν2 }, ... As for the case where p(t) ≥ for ≤ t ≤ ω, the necessary and sufficient condition for the unique solvability of (2.19), (1.2) is p(t) ≡ (see [2, Proposition 1.1, page 72]) 252 On a periodic BVP for ... supD, v(α) v(t) for t ∈ [a,α[ ¯ for t ∈ D v0 (t) = v µ(t) − v ν(t) t − ν(t) + v ν(t) µ(t) − ν(t) v(β) ¯ for t ∈ [α,β] \ D (3.25) for t ∈]β,b], where ¯ ν(t) = max{s...
Ngày tải lên: 23/06/2014, 00:20
ON A BOUNDARY VALUE PROBLEM FOR NONLINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS ROBERT HAKL Received 21 doc
... operator H can be found, for example, Robert Hakl 265 in [10, 11, 13, 15] Conditions for the solvability and unique solvability of other types of boundary value problems for (2.1) with a linear ... that for each r > there exists Mr ∈ R+ such that h(v) ≤ Mr for v ∈ C [a,b];R , v C ≤ r (2.9) There are many interesting results concerning the solvability of general boundary value problems for ... 243 therein) Auxiliary propositions First we formulate a result from [25] in a suitable for us form Lemma 4.1 Let there exist a number ρ > such that, for every δ ∈]0,1[, an arbitrary function u...
Ngày tải lên: 23/06/2014, 00:20
TWO-POINT BOUNDARY VALUE PROBLEMS FOR HIGHER-ORDER LINEAR DIFFERENTIAL EQUATIONS WITH STRONG pdf
... that x1 = x2 = for n = 2, = xm = xm+1 > · · · > x2m for n = 2m, x1 > · · · > xm > m − > xm+1 > · · · > x2m+1 for n = 2m + x1 > · · · > xm−1 > m − (1.37) Hence it is evident that for n = (1.340 ... −1) (t) = u(i−1) (t) L2 ≤ r0 , (i = 1, ,n) uniformly in ]a,b[ (2.52) (2.53) (That is, uniformly on [a + δ,b − δ] for an arbitrarily small δ > 0) Proof For an arbitrary (m − 1)-times continuously ... t) m−i+1/2 for a < t < b, for a < t < b (i = 1, ,m), (2.67) n− u ∈ Cloc (]a,b[), and (i lim uk −1) (t) = u(i−1) (t) →+∞ (i = 1, ,n − 1) uniformly in ]a,b[ (2.68) On the other hand, for any t0...
Ngày tải lên: 23/06/2014, 00:20
.H.264 and MPEG-4 Video Compression ..H.264 and MPEG-4 Video Compression Video Coding for doc
... enhanced for improved coding efficiency, including: r Small block-size transform, r Hierarchical block transform, r Short word-length transform, r Exact-match transform, r Arithmetic entropy coding, ... information loss (distortion) Further compression can be achieved by encoding the processed data using an entropy coding scheme such as Huffman coding or Arithmetic coding Image and video compression ... processes of compression (encoding) and decompression (decoding), in which bandwidth-intensive ‘raw’ digital video is reduced to a manageable size for transmission or storage, then reconstructed for display...
Ngày tải lên: 27/06/2014, 08:20
.H.264 and MPEG-4 Video Compression..H.264 and MPEG-4 VideoCompressionVideo Coding for pot
... enhanced for improved coding efficiency, including: r Small block-size transform, r Hierarchical block transform, r Short word-length transform, r Exact-match transform, r Arithmetic entropy coding, ... information loss (distortion) Further compression can be achieved by encoding the processed data using an entropy coding scheme such as Huffman coding or Arithmetic coding Image and video compression ... processes of compression (encoding) and decompression (decoding), in which bandwidth-intensive ‘raw’ digital video is reduced to a manageable size for transmission or storage, then reconstructed for display...
Ngày tải lên: 27/06/2014, 08:20
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... column chromatography [7] Results 3.1 Design and construction of the gene coding for MCoTI-II The nucleotide sequence coding for MCoTI-II was reversely translated from its amino acid sequence (fig ... chitin gel before (N1) and after (N2) releasing MCoTI-II Fig 12 Changing in SDS-PAGE protein pattern of chitin gel before and after releasing ReMCoTI-II 1,2: N1, N2 (chitin gel before and after ... Reverse primer: CGGCTCGAGTTAGCCGCAATAGCCGTTGCCGCGGCAAAT Fig 3: The sequences of the forward and reversed primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa...
Ngày tải lên: 12/02/2014, 10:20
Tài liệu Báo cáo khoa học: "Mining Wikipedia Revision Histories for Improving Sentence Compression" docx
... pair 3.4 Decoding We implemented the forest-based statistical sentence generation method of Langkilde (2000) KM tailored this method to sentence compression, compactly encoding all compressions ... corpus We solicited judgments of importance (the value of the retained information), and grammaticality for our compression, the KM results, and human compressions from judges, on a scale of (worst) ... subset of them for such compressions/expansions We make the simplifying assumption that all such edits also retain the core meaning of the sentence, and are therefore valid training data for our purposes...
Ngày tải lên: 20/02/2014, 09:20
ADVANCED VIDEO CODING FOR NEXTGENERATION MULTIMEDIA SERVICES doc
... positive value means the complexity increase = DEncodingTime(%) EncodingTime Method - EncodingTime HEVC - LS ´ 100 EncodingTime HEVC - LS (4) Differential Pixel Value Coding for HEVC Lossless Compression ... level range for determining the parameter Differential Pixel Value Coding for HEVC Lossless Compression http://dx.doi.org/10.5772/52878 In level information coding, the absolute value of each ... algorithms for lossless coding [12][13] In this chapter, we have tried to design an efficient differential pixel coding method for the HEVC lossless mode One caution in developing the HEVC lossless...
Ngày tải lên: 06/03/2014, 22:20