designing a candida albicans conjugate vaccine by reverse engineering protective monoclonal antibodies

Báo cáo sinh học: "Improve protective efficacy of a TB DNA-HSP65 vaccine by BCG priming" pdf

Báo cáo sinh học: "Improve protective efficacy of a TB DNA-HSP65 vaccine by BCG priming" pdf

Ngày tải lên : 14/08/2014, 19:22
... development and evaluation of new TB vaccines Recombinant BCG strains, DNA-based vaccines, live attenuated Mycobacterium tuberculosis vaccines and subunit vaccines formulated with novel adjuvants have ... 97:573-581 Kaufmann SH, McMichael AJ: Annulling a dangerous liaison: vaccination strategies against AIDS and tuberculosis Nat Med 2005, 11:S33-44 Williams A, Hatch GJ, Clark SO, Gooch KE, Hatch KA, Hall ... were stained with hematoxylin-eosin and the granulomatous lesions were analyzed by light microscopy (Leica, Germany) Statistical analysis All data were analyzed individually and the values were...
  • 14
  • 144
  • 0
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Ngày tải lên : 16/09/2015, 08:30
... CaMNN5: M1-F: 5' CATTACTTGTTTGAAGGAATATTTAGAAGCTGTTGTC 3' M1-R: 5' GACAACAGCTTCTAAATATTCCTTCAAACAAGTAATG 3' M2-F: 5' CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG ... first glutamic acid in each motif to alanine: E13 2A: 5′ GTTCGGCAAAGCATACTTGGAAAACGTTTTGGATATCCC 3′ 5′ GGGATATCCAAAACGTTTTCCAAGTATGCTTTGCCGAAC 3′ E23 0A: 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ ... GATCGGGTGCACTATCAC 3' GGATCCTCCCTGGCCCAATAAA 3' GGATCCGGTGCCGACATCCATTT 3' TGTAAGGGCCTTTCCAGT 3' 5' 5' 5' 5' CTATCTCCCACATGTTGGC 3' GGATCCCCTGAACTATTAGTATATC 3' GGATCCGAGAAAAACTAATGAAGTG 3' GAATTGCTGTGCAGAAAC...
  • 124
  • 400
  • 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

Ngày tải lên : 17/03/2014, 03:20
... b1fi2Mana1fi2Mana1fi2 a1 fi3Mana1fi2Mana1fi2Mana1fi2 ›6 Mana1 Mana1fi3 a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > > ›2 ›2 ›2 > > = Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > ›2 > > > a1 fi2Mana1 ; a1 fi6Mana1fi6Mana1fi6Mana1fi6 ... a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 ›2 ›2 a1 fi2Mana1 Mana1fi2 Mana1fi6 a1 fi6Mana1fi6 a1 fi3Mana1fi2 Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 ... a b Residue Signal dimension (%) Manb1fi2Mana1fiphosphate Manb1fi2Manb1fi2Mana1fiphosphate a1 fi2Mana1fi3Mana1fi2 a1 fi3Mana1fi2Mana1fi3Mana1fi2 ›6 ›6 Mana1 Mana1 Mana1fi2Mana1fi2 a1 fi2Mana1fi2Mana1fi2 b1fi2Mana1fi2Mana1fi2...
  • 11
  • 456
  • 0
Báo cáo khoa học: 2-Amino-nonyl-6-methoxyl-tetralin muriate activity against Candida albicans augments endogenous reactive oxygen species production – a microarray analysis study doc

Báo cáo khoa học: 2-Amino-nonyl-6-methoxyl-tetralin muriate activity against Candida albicans augments endogenous reactive oxygen species production – a microarray analysis study doc

Ngày tải lên : 28/03/2014, 23:20
... TTGGATGGATAAGAGGC AGTTGGCGGTGGTAAT TTCGTAAACGGCATAA AGAAACCTGCCTCCTCA CCAACCCTAATCTGTCG TAATGCCAATGAGAATG TCAGGAGGCACAAACT AACAACAACACCGTCAT TTGGCAAAGTATCGTCT CGGTCAAGGAAGCAGAA TTGGCAAAGTATCGTCT GCTATGGCTGAAGAAT ... GTGCCTTTATTGCTGAT AGATTCTGGGTCGTTTG TGAAAGGGAAAGTTGTC TCCAAGACTGGGAATGT ACTCCACAATACAAAGGTT AATACGGGGAAAGTCAC ACATTGGCGGTTTATC ATTACCTTGAGGAGCA CTGCTGCTTACGAACA AATGGGTAGACACCTCTG CGGTTACTATTTGGGAGA TTGGATGGATAAGAGGC ... TCTTTCTTGATTTTGTGGGTGG TCGATAGTCCCTCTAAGAAGTG ATCCCTGGTCTTATCTTC AACTGGGTAATCCTTGTAG CTTTATTACCAATCCCTG ATTTCTCAACCGCACC ATGCCGTATTGACTCCT CTCTTGCCTTATCCTTT AAGCCGCATACCACAA CCAACCACCACAGGAT GTGCCTTTATTGCTGAT...
  • 11
  • 336
  • 0
Báo cáo y học: "Candida albicans genome sequence: a platform for genomics in the absence of genetics" potx

Báo cáo y học: "Candida albicans genome sequence: a platform for genomics in the absence of genetics" potx

Ngày tải lên : 09/08/2014, 20:20
... over half of the What can be gleaned from the genome sequences of a pathogen such as C albicans (and from other related fungi)? C albicans has rarely been isolated in nature away from an animal ... of C albicans and C dubliniensis infections is the kidneys [5] Also, A fumigatus has evolved as a saprophyte, decomposing leaf litter, whereas C albicans appears to have an obligate association ... Genetics of Candida albicans Microbiol Rev 1990, 54:226-241 Odds FC: Candida and Candidosis 2nd edn London: Bailliere Tindall; 1988 Calderone RA: Candida and Candidiasis Washington, DC: ASM Press;...
  • 3
  • 400
  • 0
Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot

Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot

Ngày tải lên : 10/08/2014, 09:21
... echocardiography 2D transthoracic and/or transesophageal echocardiography was also performed for independent clinical assessment of AS All images were analyzed offline on semi-automatic MASS Plus and ... Blase A Carabello, Nathaniel Reichek and thankful for the support of Dr George Magovern, Jr and Srinivas Murali Presented at the American Heart Association in Orlando, Florida at the Surgical ... compliance and arterial inelasticity due to aging The surgically induced relief of afterload may be counterbalanced by the resultant increase another type of afterload; arterial hypertension [18] Another...
  • 8
  • 332
  • 0
Báo cáo y học: "A genetic code alteration generates a proteome of high diversity in the human pathogen Candida albicans" pot

Báo cáo y học: "A genetic code alteration generates a proteome of high diversity in the human pathogen Candida albicans" pot

Ngày tải lên : 14/08/2014, 08:20
... 5'-ACTAGACCGCGGGATT ATAAAGATGATGATGATAAGAACGACAAATACTCATTAGC-3', which hybridized with CaPGK1 The reverse primer 5'-ATTAGATCGCGATTAGTGATGGTGAT GGTGATGGTTTTTGTTGGAAAGAGCAAC-3' had a six-histidine tail ... 4.0 H2O2 pUA65 (2.96%) (3.9%) (4.03%) (4.95%) (28%) The Candida albicans proteome has a statistical nature Figure The Candida albicans proteome has a statistical nature (a) In C albicans, 33% of ... with appearance of an array of morphologic phenotypes Morphology variation was characterized by appearance of large sectors containing opaque cells and aerial hyphae and by formation of unusual...
  • 15
  • 226
  • 0
Thử nghiệm sinh ống mầm và thử nghiệm Dalmau trong định danh Candida Albicans và Candida Non-albicans

Thử nghiệm sinh ống mầm và thử nghiệm Dalmau trong định danh Candida Albicans và Candida Non-albicans

Ngày tải lên : 15/11/2012, 14:02
... biệt C albicans C non -albicans tình hình thực tế Việt Nam ABSTRACT Objective: to determine the efficacy of serum test (ST) and Dalmau test for identification of C albicans and C non -albicans Study ... nấm Candida C albicans; phần ba số mẫu xét nghiệm nhiễm loài C non -albicans như: C tropicalis, C krusei, C glabrata, C pseudotropicalis, C parasilosis, loài kháng trị C lusitaniae Sự phân bố Candida ... HCM Sau phục hồi môi trường Sabouraud Dextrose Agar chloramphenicol ủ nhiệt độ phòng, chủng nấm cấy lên CHROMagar Candida (tiêu chuẩn vàng) để định danh C albicans (CA) C non -albicans (CNA) dựa...
  • 17
  • 1.5K
  • 5
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Ngày tải lên : 05/09/2013, 10:15
... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...
  • 9
  • 522
  • 0
Designing a Change and Configuration Management Infrastructure

Designing a Change and Configuration Management Infrastructure

Ngày tải lên : 16/10/2013, 12:15
... Data Strategies Determining the Organizational Requirements Categorizing User Data Management Needs Identifying Available User Data Management Options .15 Selecting Appropriate ... an organization Evaluate software distribution and management options based on business needs, and based on the current and planned environment Evaluate user data management options based on business ... Distribution and Management Strategy 2:45 3:30 Module 3, Lab A: Meeting Organizational Software Requirements 3:30 3:45 Break 3:45 5:15 Module 4: Designing a User Data Management Strategy Start End...
  • 10
  • 449
  • 0
Designing A Wireless Network

Designing A Wireless Network

Ngày tải lên : 16/10/2013, 13:15
... Elements and Frequency Spectrums Introduction Transmitting Radio Signals Over EM Waves Anatomy of a Waveform Modulating a Radio Signal Propagating a Strong Radio Signal Understanding Signal Power and ... Services Creating a Detailed Physical Design Creating a Detailed Operations Design Creating a Detailed Operating Model Design Creating a Training Plan Developing a Maintenance Plan Developing an Implementation ... provider’s WAN and the provider’s central gateway to reach the Internet A wireless local area network transmits over the air by means of base stations, or access points, that transmit a radio frequency;...
  • 409
  • 290
  • 0
Designing a Public Key Infrastructure

Designing a Public Key Infrastructure

Ngày tải lên : 19/10/2013, 02:15
... Corporation All Rights Reserved Designing a Public Key Infrastructure Tasks Detailed Steps Why was the Base-64 encoded binary x.509 certificate format selected? Certificate mapping that uses an ... certificate by using Base-64 encoded binary X.509 format to a file named c:\export.cer aa Click OK bb In the details pane, right-click the certcomputer certificate, point to All Tasks, and then ... Certificates y In the details pane, double-click the Certcomputer certificate z Click the Certification Path tab What is the certification path for the certificate? EnterpriseCA =>Your Domain CA =>Web...
  • 4
  • 279
  • 0
Designing a Microsoft® Windows® 2000 Directory Services Infrastructure

Designing a Microsoft® Windows® 2000 Directory Services Infrastructure

Ngày tải lên : 04/11/2013, 13:15
... Database Administrator (MCDBA) MCDBAs are qualified to derive physical database designs, develop logical data models, create physical databases, create data services by using Transact-SQL, manage ... ([DP#3UHSDUDWLRQ#*XLGHV# To help prepare for the MCP exams, you can use the preparation guides that are available for each exam Each Exam Preparation Guide contains exam-specific information, such as a list of the ... arrange, and manage objects, such as user data, printers, and servers, so that they are available to users and applications throughout the organization Objects in Active Directory are logically organized...
  • 320
  • 288
  • 0
Tài liệu Module 2: Designing a Workstation Installation and Upgrade Strategy ppt

Tài liệu Module 2: Designing a Workstation Installation and Upgrade Strategy ppt

Ngày tải lên : 10/12/2013, 15:15
... your organization have only a few standard hardware configurations, rather than many customized configurations Module 2: Designing a Workstation Installation and Upgrade Strategy 13 Advantages ... Professional are as follows: Manual Installation Methods Manual CD-ROM installation Manual over-the-network installation Automated Installation Methods Unattended Setup (Setup Manager) System Preparation ... installations and upgrades and plan a strategy for creating teams to carry out future installations and upgrades You may need to consider additional training for Information Technology (IT) staff...
  • 42
  • 650
  • 2
Tài liệu Module 3: Designing a Software Distribution and Management Strategy ppt

Tài liệu Module 3: Designing a Software Distribution and Management Strategy ppt

Ngày tải lên : 10/12/2013, 15:15
... install and manage software: A Windows Installer package (an msi file), which is a relational database that contains information describing the installed state of the application An API that allows ... define the stages of the software management process Lead-in Each organization has its own approach, but any approach involves standard stages Packaging—Preparing an Application for Installation Distribution—Replicating ... software applications are installed Who installs the software How software upgrades and updates are installed Whether upgrades and updates are mandatory or optional How to provide application...
  • 40
  • 533
  • 0
Tài liệu Module 4: Designing a User Data Management Strategy pptx

Tài liệu Module 4: Designing a User Data Management Strategy pptx

Ngày tải lên : 10/12/2013, 15:15
... a way to easily categorize data management needs by different classifications Categorizing Data Management Needs by Job Type Lead-in Categorizing Data Management Needs by User Location To analyze ... user data management in the areas of data availability, data accessibility, and data protection and security Data Availability By using RUPs and Folder Redirection technologies, users can have immediate ... computers and who need to have access to the same data and settings on each computer 18 Module 4: Designing a User Data Management Strategy A mandatory RUP is created and managed by system administrators...
  • 48
  • 448
  • 0
Tài liệu Designing a Microsoft® Windows® 2000 Networking Services Infrastructure ppt

Tài liệu Designing a Microsoft® Windows® 2000 Networking Services Infrastructure ppt

Ngày tải lên : 10/12/2013, 16:15
... Remote Access Evaluate and create a design to connect a remote user to a private network by using the remote access features of Routing and Remote Access Evaluate and create a design to connect a ... to a private network by using the RADIUS features provided by Routing and Remote Access and Internet Authentication Service (IAS) Evaluate and design strategies for a networking services management ... contains the Trainer Preparation Presentation, a narrated slide show that explains the instructional strategy for the course, and presentation tips and caveats To open the presentation on the Trainer...
  • 14
  • 380
  • 0
Tài liệu Designing a Microsoft Windows Server 2003 Active Directory and Network Infrastructure docx

Tài liệu Designing a Microsoft Windows Server 2003 Active Directory and Network Infrastructure docx

Ngày tải lên : 11/12/2013, 14:15
... App1 automatically sends detailed information about the power failure to the nearest available field technicians All users within the company have access to App1 App1 logs on to the App1 database ... The company’s main office is located in Atlanta The company has three branch offices in the following locations: Chicago Dallas Seattle In Addition to the main office in Atlanta, there are also ... occurred Another service-level agreement states that the IT department must guarantee an available bandwidth of 28 Kbps to ensure adequate bandwidth for App1 Currently, the available bandwidth decreases...
  • 52
  • 563
  • 1
A STUDY ON LANGUAGE USED BY FLIGHT ATTENDANTS

A STUDY ON LANGUAGE USED BY FLIGHT ATTENDANTS

Ngày tải lên : 11/12/2013, 23:52
... always have available and make use of lots of differently sourced materials and training aids, as thousands are available Indeed, a key factor in language learning is that the learners have access ... aviation Such language is normally (but not always beyond the realm that English language teachers are comfortable teaching unless they have an aviation background or a deep interest in aviation ... final exam Some airlines allow retakes, some not Airlines want only the best candidates Each year flight attendants are also required to go through recurrent training and pass a safety examination...
  • 50
  • 426
  • 0
A study on ambiguity caused by ellipsis and substitution in english = nghiên cứu về sự mập mờ về nghĩa gây ra do phép tỉnh lược và phép thay thế trong tiếng anh luận văn tốt nghiệp đại học

A study on ambiguity caused by ellipsis and substitution in english = nghiên cứu về sự mập mờ về nghĩa gây ra do phép tỉnh lược và phép thay thế trong tiếng anh luận văn tốt nghiệp đại học

Ngày tải lên : 14/12/2013, 00:41
... is called 'grammatical ambiguity.' Compare tables (1) and (2) for an example of grammatical ambiguity: (1) An example of grammatical ambiguity at the phrase rank, interpreting her duck as a noun ... (1991) agrees with Halliday and Hasan (1976) that substitution operates either at nominal, verbal and clausal level 1.7.1 Nominal Substitution Halliday and Hasan (1976: 91) indicate that “The ... you actually spoke to the apothecary (pharmacist) or went to the apothecary (pharmacy) A sentence is ambiguous if it has two (or more) paraphrases which are not themselves’ paraphrases of each...
  • 23
  • 1.1K
  • 1