design of gene constructs for transgenic maize

... has generated recombinant constructs of the mature forms of PrPs from a variety of mammalian and nonmamma- lian species, and of partial sequences thereof. In addi- tion, designed variants of mouse ... Table 1. List of plasmids encoding the sequence of the mature cellular form of the prion protein from a variety of species and truncated variants thereof, and of human doppel. The protein ... lack of sufficient amounts of purified protein. The indications of the yields of expression and reconstitution for these con- structs are self-explanatory, whereby the constructs with high yields of...

Ngày tải lên: 18/02/2014, 08:20

... and pSM30 vectors generate efficient knockdown of target proteins To examine the efficiency of generation of RNAi for pSM155 and pSM30, we examined the knockdown of expression of firefly Luciferase ... sites of pEGFP-N1-Intron, respectively. A pair of oligos including cohesive ends and a specific sequence for each artificial miRNA (64 nucleotides for the miR155- based system and 67 nucleotides for ... The selection of target sequences and design of artificial miRNA stem-loops were based on the algorithms accessible at http://www.invitrogen.com/rnai (for miR155 system), http:// codex.cshl.edu (for miR30...

Ngày tải lên: 07/03/2014, 11:20

Ngày tải lên: 23/03/2014, 08:20

Ngày tải lên: 23/03/2014, 11:37

Ngày tải lên: 19/06/2014, 08:20

Ngày tải lên: 22/06/2014, 23:20

Ngày tải lên: 12/08/2014, 18:20

... parametric form for the ratio of two class-conditional distributions instead of specifying a parametric form of the class-conditional distributions themselves. By denoting the distribution of the ... set. Fig. No.4 Performance Versus Learning Rate Performance of modern techniques for rating model design 3 1. Introduction Credit risk forecasting is one of the leading topics ... performed along conjugate directions, which produces generally faster convergence than steepest descent directions. Performance of modern techniques for rating model design 17 In most of...

Ngày tải lên: 16/04/2013, 20:00

Ngày tải lên: 05/09/2013, 14:58

Ngày tải lên: 17/10/2013, 19:15

Ngày tải lên: 16/01/2014, 16:33

... proposed synthetic trypsin inhibitor gene. The sequences of the forward and reversed primers are shown on fig 3 and of the synthetic gene is on fig 4. Forward primer: 5’ GAATTCCATATG AGCGGCAGCGATGGCGGCGTGTGCCCGA ... purification of recombinant MCoTI-II were followed the manufactures instruction of IMPACT-CN System, using chitin beads column chromatography [7]. 3. Results 3.1. Design and construction of the gene ... MCoTI-II gene was synthesized by four overlapping primers ,transformated into pTYB12 vector . ♦E.coli BL21(DE3) strain was used as the host for cloning and expression of the recombinant gene ....

Ngày tải lên: 12/02/2014, 10:20

... part of this research, an initial investigation was made on the effects on performance of the reset windups for MIMO systems [11] showing potential for improving the performance ... it was described above, then x(t)e BA,C for all t and for all u(t). Proof: The proof of this Lemma follows from the construction of X(t). //// Page 17 r … Logic ' ... system There are well developed methods for defining performance criteria and for designing linear closed loop systems which meet the performance requirements. It would then...

Ngày tải lên: 18/02/2014, 10:20

... measured by flow-cytometry assay. Binding of Jurkat cells to SRBCs due to CD2 and CD58 interaction results in the formation of E-rosettes. The ability of each of the designed CD2 peptides to inhibit CD2–CD58 ... National University of Singapore for the use of computational facilities; Prof. Arthur J. Olson, the Scripps Research Institute , USA, for providing us with the AutoDock software. This research ... spectra of the peptide were prepared by dissolving 3 mg of the peptides in 0.5 mL of 90% H 2 O/10% D 2 O. For pH titration experim ents, the pH of the solution was varied by the a ddition of DCl...

Ngày tải lên: 19/02/2014, 13:20

... start sites for the integrin a3 subunit gene, a modied method of 5Â-RACE using a cap site-labeled cDNA library was employed, recently devel- oped for rapid examination of 5Â-end of genes [33]. ... upstream of the SacI) sites (Fig. 1). Sequence analysis of the 5Â-anking region and determination of transcription start sites of mouse integrin a3 subunit gene The nucleotide sequence of the 0.5 ... characteristic feature of the a3integrin gene among integrin a subunit genes. Fig. 2. Flow cytometric analysis of the expression of the integrin a3 subunit in gastric carcinoma cells. Profiles of control...

Ngày tải lên: 21/02/2014, 03:20

... and Power Generation Process Design 58 3.5.1 Heat Recovery System Design 58 3.5.2 Power Generation Process Design 59 3.5.3 Design Considerations 62 1. Gas Turbine 62 3.5.4 Design Main ... analysis of DME and FTD designs. 68 Figure 27: Mass and energy flow of DME design and FTD design. 69 34 Table 6: Contaminant specification for cobalt FT synthesis, and cleaning effectiveness of ... solution of about 15-17 % solids, the significant energy requirement for evaporation of black liquor to 80% solids for dry-feed gasification is avoided. The general operating conditions for a...

Ngày tải lên: 26/02/2014, 14:20

... wide- spread use of the SAGE technique, and has accelerated the speed of studies of large-scale gene expression. Abbreviations GLGI, generation of longer cDNA fragments from SAGE tags for gene identification; ... analysis of unknown SAGE tags (RAST-PCR) [33], generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) [34], a high-throughput GLGI procedure [32], the two-step analysis of ... technique for transcriptomics, it neverthe- less has a disadvantage. The size of the SAGE tag, 14 Keywords 3Â longer fragment cDNA; generation of longer cDNA fragments from SAGE tags for gene identification...

Ngày tải lên: 07/03/2014, 00:20

... characteristic of a-AMPs in that higher concentrations of these peptides are generally required for haemolytic action than for bactericidal action [38]. The minimum lethal concentra- tion of AP1 is ... the wedge hypo- thesis of Tytler et al. [48], it may be that insertion of the inverted wedge shape formed by the AP1 a-helix into membranes of E. coli leads to the formation of nonbilayer structures ... Science, University of Central Lancashire, Preston, UK 2 School of Natural Resources, University of Central Lancashire, Preston, UK 3 Forschungszentrum Borstel, Leibniz-Center for Medicine and Biosciences,...

Ngày tải lên: 07/03/2014, 12:20

... of the THO com- plex for the expression of long genes [14], the GLAM ratios of the two THO mutants were dramatically reduced when compared with the wild type (Fig. 6). The absence of effect of ... classify a mutant. The best assay for a rapid evaluation of gene expres- sion is the use of a reporter system. Available reporter systems allow detection of defects in gene expression, but cannot distinguish ... steps of transcription influence equally the expression of the reporters, independently of the length of their 3Â-UTR. Results An in vivo assay to measure gene length- dependent efficiency of mRNA...

Ngày tải lên: 07/03/2014, 12:20

... and 3Â-UTR of CfNR allow control of both the timing and level of expression of introduced genes in transgenic C. fusiformis. Results Increasing the efficiency of C. fusiformis transformation Previously, ... required for suppression of C. fusiformis wild-type growth. In future the promoter Pfcp may be a useful tool for generating higher levels of expression of other transgenic proteins. With the CfNR gene ... cell division or valve formation in C. fusiformis transform- ants carrying a gene of interest under control of the Pnr ⁄ Tnr cassette may be performed as outlined in the following. A transformant grown...

Ngày tải lên: 07/03/2014, 21:20