design of gene constructs for transgenic maize
Tài liệu Báo cáo khoa học: Prion protein library of recombinant constructs for structural biology docx
... hasgenerated recombinant constructs of the mature forms of PrPs from a variety of mammalian and nonmamma-lian species, and of partial sequences thereof. In addi-tion, designed variants of mouse ... Table 1. List of plasmids encoding the sequence of the mature cellular form of the prion protein from a variety of species and truncatedvariants thereof, and of human doppel. The protein ... lack of sufficientamounts of purified protein. The indications of theyields of expression and reconstitution for these con-structs are self-explanatory, whereby the constructs with high yields of...
- 9
- 458
- 1
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx
... and pSM30 vectors generateefficient knockdown of target proteinsTo examine the efficiency of generation of RNAi for pSM155 and pSM30, we examined the knockdown of expression of firefly Luciferase ... sites of pEGFP-N1-Intron, respectively. A pair of oligos including cohesive ends and a specific sequence for each artificial miRNA (64 nucleotides for the miR155-based system and 67 nucleotides for ... Theselection of target sequences and design of artificial miRNAstem-loops were based on the algorithms accessible athttp://www.invitrogen.com/rnai (for miR155 system), http://codex.cshl.edu (for miR30...
- 7
- 514
- 0
Performance of Modern Techniques for Rating Model Design
... parametric form for the ratio of two class-conditional distributions instead of specifying a parametric form of the class-conditional distributions themselves. By denoting the distribution of the ... set. Fig. No.4 Performance Versus Learning Rate Performance of modern techniques for rating model design 3 1. Introduction Credit risk forecasting is one of the leading topics ... performed along conjugate directions, which produces generally faster convergence than steepest descent directions. Performance of modern techniques for rating model design 17 In most of...
- 23
- 510
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... proposed synthetic trypsin inhibitor gene. The sequences of the forward and reversed primers are shown on fig 3 and of the synthetic gene is on fig 4. Forward primer: 5’ GAATTCCATATGAGCGGCAGCGATGGCGGCGTGTGCCCGA ... purification of recombinant MCoTI-II were followed the manufactures instruction of IMPACT-CN System, using chitin beads column chromatography [7]. 3. Results 3.1. Design and construction of the gene ... MCoTI-II gene was synthesized by four overlapping primers ,transformated into pTYB12 vector . ♦E.coli BL21(DE3) strain was used as the host for cloning and expression of the recombinant gene ....
- 9
- 497
- 0
Tài liệu Design of Feedback Control Systems for Stable Plants with Saturating Actuators ppt
... part of thisresearch, an initial investigation was made on the effects on performance of the reset windups for MIMO systems [11] showing potential for improving the performance ... it was describedabove, then x(t)e BA,C for all t and for all u(t).Proof: The proof of this Lemma follows from the construction of X(t). //// Page 17r … Logic ' ... systemThere are well developed methods for defining performance criteria and for designing linearclosed loop systems which meet the performance requirements. It would then...
- 39
- 595
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
... measured by flow-cytometry assay. Binding of Jurkat cellsto SRBCs due to CD2 and CD58 interaction results in theformation of E-rosettes. The ability of each of thedesigned CD2 peptides to inhibit CD2–CD58 ... National University of Singapore for the use of computationalfacilities; Prof. Arthur J. Olson, the Scripps Research Institute , USA, for providing us with the AutoDock software. This research ... spectra of the peptide wereprepared by dissolving 3 mg of the peptides in 0.5 mL of 90% H2O/10% D2O. For pH titration experim ents, the pH of the solution was varied by the a ddition of DCl...
- 14
- 657
- 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
... start sites for the integrina3 subunit gene, a modied method of 5Â-RACE using a capsite-labeled cDNA library was employed, recently devel-oped for rapid examination of 5Â-end of genes [33]. ... upstream of the SacI) sites (Fig. 1).Sequence analysis of the 5Â-anking region anddetermination of transcription start sites of mouseintegrin a3 subunit gene The nucleotide sequence of the 0.5 ... characteristic feature of the a3integrin gene among integrin a subunit genes.Fig. 2. Flow cytometric analysis of the expression of the integrin a3subunit in gastric carcinoma cells. Profiles of control...
- 9
- 562
- 0
Tài liệu Novel Design of an Integrated Pulp Mill Biorefinery for the Production of Biofuels for Transportation pot
... and Power Generation Process Design 583.5.1 Heat Recovery System Design 583.5.2 Power Generation Process Design 593.5.3 Design Considerations 621. Gas Turbine 623.5.4 Design Main ... analysis of DME and FTD designs. 68Figure 27: Mass and energy flow of DME design and FTD design. 69 34Table 6: Contaminant specification for cobalt FT synthesis, and cleaning effectiveness of ... solution of about 15-17 % solids, the significant energy requirement for evaporation of black liquor to 80% solids for dry-feed gasification is avoided. The general operating conditions for a...
- 105
- 518
- 0
Báo cáo khoa học: Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags doc
... wide-spread use of the SAGE technique, and has accelerated the speed of studies of large-scale gene expression.AbbreviationsGLGI, generation of longer cDNA fragments from SAGE tags for gene identification; ... analysis of unknown SAGE tags (RAST-PCR) [33], generation of longer cDNA fragments from SAGE tags for gene identification (GLGI) [34], a high-throughput GLGIprocedure [32], the two-step analysis of ... technique for transcriptomics, it neverthe-less has a disadvantage. The size of the SAGE tag, 14Keywords3Â longer fragment cDNA; generation of longer cDNA fragments from SAGE tags for gene identification...
- 12
- 544
- 0
Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot
... characteristic of a-AMPs in that higher concentrations of these peptidesare generally required for haemolytic action than for bactericidal action [38]. The minimum lethal concentra-tion of AP1 is ... the wedge hypo-thesis of Tytler et al. [48], it may be that insertion of the inverted wedge shape formed by the AP1 a-helixinto membranes of E. coli leads to the formation of nonbilayer structures ... Science, University of Central Lancashire, Preston, UK2 School of Natural Resources, University of Central Lancashire, Preston, UK3 Forschungszentrum Borstel, Leibniz-Center for Medicine and Biosciences,...
- 12
- 688
- 0
Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc
... of the THO com-plex for the expression of long genes [14], the GLAMratios of the two THO mutants were dramaticallyreduced when compared with the wild type (Fig. 6).The absence of effect of ... classify a mutant.The best assay for a rapid evaluation of gene expres-sion is the use of a reporter system. Available reportersystems allow detection of defects in gene expression,but cannot distinguish ... steps of transcription influence equally theexpression of the reporters, independently of the length of their 3Â-UTR.ResultsAn in vivo assay to measure gene length-dependent efficiency of mRNA...
- 14
- 435
- 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... and 3Â-UTR of CfNR allow control of both the timing and level of expression of introducedgenes in transgenic C. fusiformis.ResultsIncreasing the efficiency of C. fusiformistransformationPreviously, ... required for suppression of C. fusiformis wild-type growth. In future the promoterPfcp may be a useful tool for generating higher levels of expression of other transgenic proteins.With the CfNR gene ... celldivision or valve formation in C. fusiformis transform-ants carrying a gene of interest under control of thePnr ⁄ Tnr cassette may be performed as outlined in thefollowing. A transformant grown...
- 11
- 668
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25