delete a cell range name

... Existing Namespace  Separate Public and Private Namespace  Single Subdomain Within Namespace  Multiple Subdomains Within Namespace  No Changes to Namespace  Separate Public and Private Namespace  ... DNS servers that have replicated zones at local and remote locations can enhance the availability of DNS. By adding additional DNS servers at remote locations, DNS availability can be ensured ... not have access to the private namespace.  Minimal impact on the existing namespace and effort on the part of the current DNS administrators. Single Subdomain Within Namespace Creating a...

Ngày tải lên: 17/01/2014, 08:20

Ngày tải lên: 21/03/2014, 21:59

Ngày tải lên: 21/03/2014, 21:59

... of the PNA derivatives studied. Compound Sequence MAP KLALKLALKALKAALKLA-NH 2 I Fluos-GGAGCAGGAAAG-Lys (antisense) II Fluos-GGAGCAGGAAAG-MAP (antisense) III Fluos-AGGAGCAGGGAA-MAP (scrambled) 3044 ... peptide KLALKLALKALK AALKLA-NH 2 (MAP) to d eliver p eptide nucleic acids (PNAs) into mammalian cells, MAP was covalently linked to the 12-mer P NA 5¢-GGAGCAGGAAAG-3¢ directed against t he mRNA of ... reports about substan- tially enhanced bioavailability of P NA after conjugation with natural CPPs [3–8], an almost one order of magnitude higher intracellular PNA concentration was achieved after exposing...

Ngày tải lên: 23/03/2014, 13:20

... survival across sub-Saharan Africa. USAID officials told us that grantees may pilot innovations (see sidebar) or work in a country’s most rural and hard-to-reach areas. Also, in certain cases, ... bureau managed several projects for the India mission. Technical Assistance • The bureau managed a program for anemia reduction and vitamin A supplementation in the states of Uttar Pradesh and ... reports, and program reports, such as the Bureau for Africa’s Child Survival in Sub-Saharan Africa – Taking Stock. We assessed the reliability of financial data compiled and generated by USAID’s...

Ngày tải lên: 28/03/2014, 09:20

... necrosis mediated by tumor necrosis factor. J Exp Med 187, 1477–1485. 62 Sasazuki T, Okazaki T, Tada K, Sakon-Komazawa S, Katano M, Tanaka M, Yagita H, Okumura K, Tominaga N, Hayashizaki Y et al. (2004) ... NF-kappaB activation [corrected]. Nat Cell Biol 8, 398–406. 18 Tokunaga F, Sakata S, Saeki Y, Satomi Y, Kirisako T, Kamei K, Nakagawa T, Kato M, Murata S, Yamaoka S et al. (2009) Involvement of linear ... signaling pathways. Nat Immunol 8, 592–600. 73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C (2010) A bacterial E3 ubiqu- itin ligase IpaH9.8 targets NEMO ⁄ IKKgamma to dam- pen...

Ngày tải lên: 28/03/2014, 23:20

... CCATACCTCAAGTATTTGCCATC 67 (CCNA2) R: TCCAGTCTTTCGTATTAATGATTCAG Cyclin B1 NM031966 F: CATGGTGCACTTTCCTCCTT 18 (CCNB1) R: AGGTAATGTTGTAGAGTTGGTGTCC Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA ... p53-inducible modulator of cell fate in response to genotoxic stress. Cancer Res 2007, 67:11317-11326. 21. Miyake H, Hanada N, Nakamura H, Kagawa S, Fujiwara T, Hara I, Eto H, Gohji K, Arakawa S, Kamidono ... common cell cycle activa- tors. These data emphasize that early-stage CRC cells thatareabletooverexpressKIAA0247couldimpede the progression of the cell cycle at the G2/M phase if an appropriate amount...

Ngày tải lên: 18/06/2014, 19:20

... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... recombination "hot-spot" in the plus- and minus- sense S RNA of TULV. GGAAAUG GCCAAGU G-C A- U G-C A- U U -A G G U -A G:U C A- U U -A 337 381 (+) sense U:G U -A C U C-G U -A C-G U -A C-G U -A A-U C...

Ngày tải lên: 18/06/2014, 22:20

... when activated by β-amyloid, bacteria and/or cytokines, the oxidase assembles at the plasma membrane, and produces superoxide that is released extracellularly or into phagosomes at a high rate. ... (non- inflammed) brain are low (roughly 5% of all brain cells) [34]. Microglia are a major source of pro-inflammatory cytokines, particularly IL-1β and TNF-α, that cause inflammatory activation of ... soluble A 1–40 , with apocynin, catalase or EUKs without A ; with 10 pg/ml phorbol 12-myristate 13-acetate (PMA, an NADPH oxidase activator), or with PMA together with apocynin or catalase. After...

Ngày tải lên: 19/06/2014, 22:20

... Y, Sakamoto K, Yamada A, Hotta A, Ohya S, Muraki K, Uch- iyama M, Ohwada T: Molecular basis of pimarane compounds as novel activators of large-conductance Ca(2+)-activated K(+) channel alpha-subunit. ... individual plates, and the aggregate Z' value from all plates and all days was 0.64. A signal-to-noise value of 4.96 was calculated with the aggregate data from all plates. All of the statistical ... mshaneyf@gonzaga.edu; Anna D Burke - annaburke@montana.edu; Joel W Graff - jgraff@montana.edu; Mark A Jutila - uvsmj@montana.edu; Michele E Hardy* - mhardy@montana.edu * Corresponding author Abstract Background:...

Ngày tải lên: 20/06/2014, 01:20

Ngày tải lên: 20/06/2014, 03:20

Ngày tải lên: 20/06/2014, 04:20

Ngày tải lên: 20/06/2014, 04:20

... Naoko Chayahara 3 , Ikuya Miki 3 , Takao Tamura 3 , Tsubasa Inokuma 2 , Yoshiji Takemoto 2 , Tsutomu Nakamura 3 , Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3  1. School of Pharmacy ... cases after definitive chemoradiotherapy for eso- phageal squamous cell carcinoma. J Gastroenterol. 2006; 41: 425-32. 10. Sakaeda T, Yamamori M, Kuwahara A, et al. Pharmacokinetics and pharmacogenomics ... M, Manda R, et al. Efficacy and toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 2003; 23: 3493-8. 15. Yamada H, Maki H, Takeda Y,...

Ngày tải lên: 26/10/2012, 09:53

... of human gastric cancer cell line (AGS) before and after CKBM treatment using Western blot analysis. 2. Materials and Methods Cell culture Human gastric cancer cell line (AGS) was obtained ... 35.4 Events Events Events Events Events Events Events Events Events PI-Area (control) PI-Area (control) PI-Area (control) PI-Area (5%) PI-Area (5%) PI-Area (10%) PI-Area (10%) PI-Area (10%) PI-Area (15%) 10 0 10 1 10 2 10 3 PI-Area (15%) 0 512 Events PI-Area ... Cignetti A, Rovera G, Foa R. Retroviral vector-mediated transfer of the tumour necrosis factor alpha gene into human cancer cells restores an apoptotic cell death program and induces a bystander-killing...

Ngày tải lên: 02/11/2012, 11:12

... bandwidth, large variable gain range, and very small group delay variation. A differential pair can be linearized with diode-connected loads. But in large gain cases, the linear range and bandwidth ... its advantages and drawbacks. (1) Linear range The linear range of the multiplier-based VGA depends on the control voltage level y v . Hence, when the DC voltage gain increases, the linear range ... scale of the ADC. Thus, the suitable VGA topology for this design has to provide at least 1V pp linear range with large variable gain range (42dB). The linear range of the differential pair...

Ngày tải lên: 06/11/2012, 10:26

Ngày tải lên: 05/09/2013, 14:58

Ngày tải lên: 05/09/2013, 14:58

Ngày tải lên: 05/09/2013, 14:58

Ngày tải lên: 05/09/2013, 14:58