d where does she come from
3 4 1 where does that come from
Ngày tải lên :
21/04/2017, 09:01
... found underground We use oil for fuel Fuels provide us with heat and light Oil wells are dug underground to reach the oil Did that really come from Earth? The different regions of the United States ... gum also come from trees 10 Gold is a shiny yellow mineral 11 How did they get to the gold? Gold is usually found in rock or mixed with soil Miners panned for gold They swirled water from streams ... gold from the dirt Later, people dug deep holes in the earth called mines They searched for larger chunks of gold Then what happened? Not many miners got rich By 1850 a lot of people decided to...
- 10
- 117
- 0
Where do grids come from
Ngày tải lên :
21/10/2014, 10:11
... creates, reads, and edits info subdirectories and corresponding data files Concept Grid directory structure Grid subdirectories store data files about each grid Some grid data files have related INFO ... have related INFO files called the nit and dat pairs These files have filename extensions nit and dat The vat.adf, sta.adf, and dblbnd.adf files in a grid subdirectory have corresponding INFO ... command does not remove all of that grid's data files Use the Source Manager (discussed later in this section) to delete grid directories The info subdirectory contains data files about each grid...
- 22
- 211
- 0
Báo cáo y học: "Where does the lactate come from? A rare cause of reversible inhibition of mitochondrial respiration" pdf
Ngày tải lên :
13/08/2014, 20:21
... early use of dialysis [14] in order to accelerate drug elimination Abbreviations NAD, nicotinamide adenine dinucleotid; NADH, reduced form of NAD Competing interests The authors declare that ... indirect measurement of oxygen consumption, Protti and colleagues found that body oxygen consumption was markedly depressed despite a normal cardiac index evoking an inhibition of mitochondrial ... of mitochondrial function during cyanide poisoning is associated with death in the absence of antidote [12], and, similarly, since lactic acidosis associated with the use of nucleoside analogue...
- 2
- 233
- 0
báo cáo sinh học:" Ageing medical workforce in Australia - where will the medical educators come from?" ppt
Ngày tải lên :
18/06/2014, 17:20
... Force Surveys The Medicare data was provided from 1984-85 to 2004-05 and the Medical Labour Force Survey data from 1995 to 2003 The census was conducted before 1995, but the definitions for specialists ... participated in the drafting and editing of the manuscript, data analysis and interpretation of the findings SF participated in the drafting and editing of the manuscript, data analysis and interpretation ... to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your...
- 6
- 327
- 0
Where Does Computational Media Aesthetics Fit? docx
Ngày tải lên :
07/03/2014, 17:20
... general is difficult, and it’s often exacerbated by small data sets In particular, no standard test sets exist for automated video understanding, as they for image databases and similar domains, ... grammar embodies knowledge drawn from wide experience with the domain; it’s the distillate of a very large data set indeed Film grammar also provides the reference point for deciding the most ... multimedia data into shots alone Although it might be useful for a class of readers, it would be inadequate to the needs of most readers The inadequacy of purely shot-based indexes has prompted researchers...
- 10
- 267
- 0
Where Do I Go From Here? Civilian Transition ppt
Ngày tải lên :
18/03/2014, 03:20
... entirely different world You learned so many new things: different terminology; different policies and procedures; a different culture and doing extraordinary and complicated tasks You learned how ... the same time,” said Heinstrom If Heinstrom does indeed try to stay in the medical field, he may find that the level of translations needed for his resume differ from those needed by Lapple In some ... traditional sources of student aid during your undergraduate years Don’t: Lose Track of Critical Service Documents Your DD 214 (Report of Separation) papers provide proof and dates critical to determining...
- 43
- 996
- 0
Lessons Learned from the Field: Where do we go from here? docx
Ngày tải lên :
22/03/2014, 12:20
... received from health care providers when they did inquire about their symptoms; indeed, many indicated that doctors and other providers told them that discharge was no cause for concern We learned from ... a method for diagnosis and case management for asymptomatic women and those who not report symptoms To address this, a study conducted in Thailand developed an algorithm for diagnosis and management ... approach is used No useful blood test exists Candida organisms can be grown in culture, which is the "gold standard" for their diagnosis Antigen detection tests have been developed for candida, but...
- 77
- 304
- 0
Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx
Ngày tải lên :
30/03/2014, 16:20
... of DltA toward all proteinogenic amino acids in addition to d- Ala and several other d- amino acids was determined Until now, no d- aa activating A-domain had been characterized All A-domains described ... 100K 20K 0 50K 200 400 600 800 1000 [d- Ala] [µM] D -A D -A la llo -Il D e -O D rn -T y D r -C y D s -L eu D -P h D e -V a D l -P ro D -A D sp -A b D u -T r D p -G L- lu A s L- p Ph L- e G l L- ... failed because saturation could not be reached (data not shown) In addition, DltD was shown to exhibit thioesterase activity toward d- alanylated ACP [9] which indicates that loading of ACP by DltA...
- 11
- 407
- 0
báo cáo khoa học: "Where does public funding for HIV prevention go to? The case of condoms versus microbicides and vaccines" pot
Ngày tải lên :
11/08/2014, 14:21
... under Official Development Aid (ODA) Data availability is a third reason While data on public funding are relatively easily detectable, data on private funds are scattered and no integrated database ... Interdisciplinary Demographic Institute (NIDI), The Hague, Netherlands Authors’ contributions AJTPP coordinated and conducted the study and drafted the manuscript MMS performed the tailor-made data-analysis ... primary donors, i.e European governments including the European Commission, and the USA The funding comes directly from these public funding agencies, and is directed to research bodies and international...
- 10
- 387
- 0
Báo cáo y học: "If good things come from above, do bad things come from below" ppt
Ngày tải lên :
12/08/2014, 12:20
... Noble B: Bone microdamage and cell apoptosis Eur Cell Mater 2003, 6:46-55 doi:10.1186/ar3007 Cite this article as: Findlay DM: If good things come from above, bad things come from below? Arthritis ... and colleagues, however, suggested that more than 50% of the glucose, oxygen and water requirements of cartilage are provided by perfusion from the subchondral vessels [5] They described the dense ... cartilage and subchondral bone results in degeneration of the cartilage, and osteoblasts from OA subchondral bone conferred catabolic changes in articular chondrocytes [7] Secondly, osteocyte death...
- 2
- 217
- 0
Báo cáo khoa học: "Evidence-based guidelines for bleeding in trauma patients: where do we go from here" ppt
Ngày tải lên :
13/08/2014, 03:20
... recommendation from the bleeding management guideline states that, ‘We recommend that patients presenting with haemorrhagic shock and an identified source of bleeding undergo an immediate bleeding ... of evidence-based guidelines is to help develop recommendations not only to identify the best practice but also to decrease variability in delivery of care However, while more definitive data ... many guidelines - including many of those in the present discussion - must remain fairly broad in order to accommodate controversial and divergent points of view Accordingly, the European guideline...
- 2
- 151
- 0
Báo cáo y học: "Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP)" pps
Ngày tải lên :
13/08/2014, 13:22
... D D V I P E D W K P D 235 accgtctacaagtccaagatccagttctga T V Y K S K I Q F * 244 Figure Nucleotide sequence of Cyn d and its deduced amino acid sequence Nucleotide sequence of Cyn d and its deduced ... recombinant Cyn d protein and its derivatives for this study Expression and purification of rCyn d and its derived fragments and deletion mutants We derived a full-length Cyn d fragment as a cDNA clone ... study by Esch and Klapper on Lol p 1, three deletion mutants D1 , D2 and D3 were generated A stretch of fifty amino acids, positioned 120 to 170, was removed in D1 since these additional residues...
- 12
- 226
- 0
thuyết trình : How have most companies in Vietnam been financed since 1986 macroeconomics reform, and does this differ from other nations?
Ngày tải lên :
15/04/2015, 23:09
... government, skilled work force, and advanced and efficient infrastructure have attracted investments from more than 7,000 multinational corporations from the United States, Japan, and Europe Also ... period: The economy has experienced rapid growth Vietnam is in the period of integrating into the world's economy as a part of globalization and the country has been rising as a leading ... liquidity for the goods - Property sale: You can sell some assets you own such as housing, cars, stocks, jewelry - Debt collection: Debt is the single thing has always existed in the industry...
- 27
- 470
- 0
Báo cáo y học: "Does switching from oral extended-release methylphenidate to the methylphenidate transdermal system affect health-related quality-of-life and medication satisfaction for children with attention-deficit/hyperactivity disorder&
Ngày tải lên :
25/10/2012, 10:06
... manuscript Appendix ADHD Impact Module - Child (AIM-C)© Item Content Thinking about your child's ADHD during the past weeks, how much does each statement describe your child? • My child did well following ... schedule and final dosages by ADHD medication at baseline Baseline ADHD Medication Baseline Dose, mg /d Converted MTS Dose, mg/9 hour Final MTS Dose Subjects, n (%) Ritalin LA® (n = 26) Metadate ... in HRQL observed in children with ADHD coupled with the decreased direct and indirect costs associated with the disorder may lead to MTS being a cost-effective treatment option from a societal...
- 12
- 757
- 0
Báo cáo y học: "Does Flavanol Intake Influence Mortality from Nitric Oxide-Dependent Processes
Ngày tải lên :
31/10/2012, 15:12
... effect of gender and age DIAGNOSIS Total CV Disease Cancers Accidents Respiratory Diseases Infectious Diabetes GI Disorders Urinary Sys Diseases Unclassified Symptoms Brain Disorders Excl Strokes ... mainland and islands, and there is a difference favor- 57 ing the islands, but it is small [30] Another possible difference is diet We and others have examined the diet in the San Blas and Kuna ... thousand population were tabulated for various causes of death, both with and without age-adjustment and relative risk and 95 percent confidence interval were calculated We used the Student’s...
- 6
- 396
- 0