ct mr performed in nasopharyngeal carcinoma

... metastasis in nasopharyngeal carcinoma Int J Radiat Oncol Biol Phys 2009, 73:194-201 22 Perez CA, Devineni VR, Marcial-Vega V, Marks JE, Simpson JR, Kucik N: Carcinoma of the nasopharynx: factors affecting ... Johnson PJ: Final report of a randomized trial on altered-fractionated radiotherapy in nasopharyngeal carcinoma prematurely terminated by significant increase in neurologic complications Int J Radiat ... affecting prognosis Int J Radiat Oncol Biol Phys 1992, 23:271-280 23 Erkal HS, Serin M, Cakmak A: Nasopharyngeal carcinomas: analysis of patient, tumor and treatment characteristics determining...

Ngày tải lên: 09/08/2014, 09:20

... Rubin DB: Tasks in statistical inference for studying variation in medicine Med Care 1993, 31:YS103-110 20 Rubin DB: Estimating causal effects from large data sets using propensity scores Ann Intern ... these factors To calculate the propensity score, patient characteristics in this study were entered into a logistic regression model predicting selection for high-volume surgeons These characteristics ... analysis in this study, these limitations are unlikely to compromise our results In summary, our findings support the conclusion that provider volume affects survival outcome in NPC Analysis using...

Ngày tải lên: 09/08/2014, 09:20

... the internucleosomal linker DNA They also cleave at the borders of chromatin loops, releasing chromatin domains of sizes ≥ 50 kb [11] This chromatin loop domain structure is maintained by the interaction ... respectively PCR products were analyzed on 1% agarose gel in 0.5× TBE buffer The primers used were 5′-GCCAGTGGACTA CTAAAACC-3′ and 5′-CTTGTGGGTCAGCAATT CCTTC-3′ in the first round, 5′-CTTCTATCTTCCCATGTTC-3′ ... aberrations in infected cells [17] Similarly, LMP1 expression was found to induce aneuploidy in human epithelial cells [25] Knowing that EBV infection and LMP1 expression induce apoptosis in mammalian...

Ngày tải lên: 10/08/2014, 05:21

... role in maintaining latent EBV infection EBNA1 has Gly-Ala repeats located in its N-terminal The repeats may generate a cis-acting inhibitory signal that interferes with antigen processing and ... cis elements involved in regulating Rp activity - 12 - Introduction including sites for binding cellular transcription factors NF1, Sp1, YY1, Zif and EBV ZEBRA ZEBRA can activate Rta in all cell ... this carcinoma (Xu et al., 2000) Interestingly, by studying the preinvasive nasopharyngeal lesion related to NPC, including dysplasia and carcinoma in situ, LMP1 was found to be expressed in most...

Ngày tải lên: 05/10/2015, 22:32

... unable to inhibit NK cells, hence triggering increased cytolysis of EBV-infected cells, decreasing risk for NPC Abstract ii A trend of increasing risk with increasing number of activating KIRs ... I#B inhibitor of nuclear factor-kappa B IFN interferon Ig immunoglobulin IKK inhibitor of nuclear factor-kappa B-kinase complex IL interleukin IRAK interleukin-1 receptor associated kinase IRF interferon ... ssRNA single-stranded RNA Syk spleen tyrosine kinase TBK1 transforming growth factor-beta-associated kinase-binding kinase TCR T cell receptor TGF transforming growth factor TIR Toll/interleukin-1...

Ngày tải lên: 08/11/2015, 17:24

... SCC : squamous cell carcinoma, NKC : non-keratinizing carcinoma, UC : undifferentiated carcinoma d Clinical staging: primary tumor extension classified T2, T3 or T4 according to AJCC/UICC (1997); ... staining was minimal, a fraction of cells were nevertheless LMP1-positive with moderate intensity, thus resulting in a score of In contrast, we found a complete absence of staining on sections ... sections of lung or laryngeal carcinomas used as negative controls, resulting in a minimal score of (Fig and data not shown) In the NPC sections with minimal LMP1 staining, we found no specific features...

Ngày tải lên: 19/06/2014, 08:20

... SCC : squamous cell carcinoma, NKC : non-keratinizing carcinoma, UC : undifferentiated carcinoma d Clinical staging: primary tumor extension classified T2, T3 or T4 according to AJCC/UICC (1997); ... staining was minimal, a fraction of cells were nevertheless LMP1-positive with moderate intensity, thus resulting in a score of In contrast, we found a complete absence of staining on sections ... sections of lung or laryngeal carcinomas used as negative controls, resulting in a minimal score of (Fig and data not shown) In the NPC sections with minimal LMP1 staining, we found no specific features...

Ngày tải lên: 20/06/2014, 04:20

... undifferentiated carcinoma (UC, WHO type III) samples, followed by 35.3% (12/34) in non-keratinizing carcinoma (NKC, WHO type II) and 17.6% (6/34) in keratinizing squamous cell carcinoma (SCC, WHO ... SJ, Liu ST: Detection of an Epstein-Barr-virus variant in T-cell-lymphoma tissues identical to the distinct strain observed in nasopharyngeal carcinoma in the Taiwanese population International ... loss of XhoI restriction site was detected in 40.0% (2/ 5) of the keratinizing squamous cell carcinoma (SCC, WHO type I) samples, 87.5% (14/16) of the non-keratinizing carcinoma (NKC, WHO type...

Ngày tải lên: 09/08/2014, 07:21

... be affected by imaging modalities (CT or MR imaging), measuring protocols, and measurement techniques [17] Rasch et al indicated that MRI-derived tumor volume is smaller and has less interobserver ... factors such as tumor extension, intrinsic resistance, or hypoxia should be considered for integration into the staging system Conclusions Since this is a retrospective study, a number of factors ... Hsieh CY, Chang TH, Lin JP, Huang CC, Wang AY: Prognostic factors affecting the outcome of nasopharyngeal carcinoma Jpn J Clin Oncol 2003, 33:501-8 Greene FL, Page DL, Fleming ID, Fritz A, Balch...

Ngày tải lên: 09/08/2014, 08:22

... space involvement in nasopharyngeal carcinoma Int J Radiat Oncol Biol Phys 2002, 52:957-63 Heng DM, Wee J, Fong KW, Lian LG, Sethi VK, Chua ET, et al: Prognostic factors in 677 patients in Singapore ... in Singapore with nondisseminated nasopharyngeal carcinoma Cancer 1999, 86:1912-20 Teo P, Shiu W, Leung SF, Lee WY: Prognostic factors in nasopharyngeal carcinoma investigated by computer tomography–an ... retrospective study of the role of intracavitary brachytherapy and prognostic factors determining local tumor control after primary radical radiotherapy in 903 non-disseminated nasopharyngeal carcinoma...

Ngày tải lên: 09/08/2014, 09:20

... Huang AT: Examining prognostic factors and patterns of failure in nasopharyngeal carcinoma following concomitant radiotherapy and chemotherapy: impact on future clinical trials Int J Radiat Oncol ... Christiansen H: Nasopharyngeal carcinoma in adults: treatment results after long-term follow-up with special reference to adjuvant interferon-beta in undifferentiated carcinomas J Cancer Res Clin Oncol ... infection and nasopharyngeal carcinoma in Taiwanese men N Engl J Med 2001, 345:1877-1882 38 Liu MT, Yeh CY: Prognostic value of anti-Epstein-Barr virus antibodies in nasopharyngeal carcinoma (NPC)...

Ngày tải lên: 09/08/2014, 09:21

... boost in fractions after conformal RT to a total dose of 70Gy[53] By stringently limiting doses to the temporal lobes, using conventional fraction size, adoption of IMRT and replanning during IMRT, ... mutifactorial etiologies of TLN including dose fraction size should always be kept in mind when treating NPC patients In cases where a definite diagnosis of TLN is difficult to make according to ... rise in signal intensity is noted The transient drop in the signal intensity is prominent in tumors, as a result of their increased angiogenesis, that results in the magnetic susceptibility effects...

Ngày tải lên: 09/08/2014, 09:21

... with increased acute and long term morbidities [1,2] Increasing effort has been directed toward developing molecular targeted therapies for the treatment of NPC with increasing interest in cyclooxygenase-2 ... staining; 1–4, weak staining; 5–8, moderate staining; and 9–12, strong staining For the purpose of statistical analysis, the cohort was grouped into tumors with negligible or weak staining (N = 34) versus ... COX-2 staining was scored from to 3, and the intensity of staining scored from to The scores were then multiplied together and the final scores classified as follow: 0, negligible staining; 1–4,...

Ngày tải lên: 09/08/2014, 10:20

... harbors vital functional domains: dimerization, DNA binding, and transactivation domains [10] The AA mutations in BRLF1 functional domains were summarized in Table In this study, the domain of dimerization ... transcriptional activator, Rta plays an important role in the switch from latency to a productive infection Three domains, dimerization, DNA binding, and transactivation, contribute to this function In this ... http://www.virologyj.com/content/7/1/341 binding motif previously [10] The transcriptional activation domain is found in the C-terminal region of the protein An obligatory acidic activation domain (AA 520 to 605) contains highly...

Ngày tải lên: 12/08/2014, 02:20

... 7-AAD 7-amino-actinomycin D AIF Apoptosis-inducing factor AP-1 Activator protein-1 APC Adenomatous polyposis coli APC/C Anaphase-promoting complex/cyclosome Apaf-1 Apoptotic-activating factor-1 ... inactivated This is brought about by cdk2-cyclin A binding to and phosphorylating the E2F-DP complex, in the process inactivating its DNA binding ability (Xu et al., 1994) There is a checkpoint ... 5.5 Quercetin-induced growth inhibition and cell death in nasopharyngeal carcinoma cells are associated with increase in Bad and hypophosphorylated retinoblastoma expressions Luteolin induces G1...

Ngày tải lên: 10/09/2015, 15:53

... (not)? Find these words in your dictionary They are all in the story bread roll coins cover hide manager mustard pot napkin pretend smell vase violin a Which things can you find on a table in a ... arrived at Mr Bean's table with a bottle of wine 'Would you like to try the wine, sir?' he said 'Oh, yes please,' said Mr Bean The waiter put some wine in Mr Bean's glass and Mr Bean had a drink It ... again Mr Bean smiled Now everything was all right 'Now I can start again,' he thought 'And this time I'll everything right.' The waiter arrived at Mr Bean's table He put a plate in front of Mr...

Ngày tải lên: 24/01/2013, 12:07

... brain Generally, this a-keto acid is associated with protective effects against hypoxia and reoxygenation This is mainly ascribed to its ability to maintain redox status [17], intervening in ... shown) This is in line with our previous work [29] indicating enhancement of glycolysis activity in the presence of pyruvate Increased glycolysis might thus maintain the ATP supply during oxygen ... new insights into the role of pyruvate in tumor cells during hypoxia We show here that tumor HepG2 cells are inclined to maintain extracellular pyruvate at a constant level (0.4 mm) Hypoxia inhibits...

Ngày tải lên: 18/02/2014, 16:20

... Hyaluronic Acid injection  Autologous fat injection   Laser hair removal  IPL Laser Treatment  Microdermabrasion  Chemical peel  Noninvasive Tightening  Laser Skin Resurfacing  Calcium Hydroxylapatite injection  ... National Societies of the following countries materially restated their country’s estimated number of plastic surgeons in 2010 compared to the  figure used in 2009:  Brazil; China; Colombia; France; Italy; and United Kingdom.  This may affect ranking comparisons, since 2009 rankings were  not recomputed.  ... National Societies of the following countries materially restated their country’s estimated number of plastic surgeons in 2010 compared to  the figure used in 2009:  Brazil; China; Colombia; France; Italy; and United Kingdom.  This may affect ranking comparisons, since 2009  rankings were not recomputed. ...

Ngày tải lên: 07/03/2014, 17:20

... PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA ... GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom ... CO2 Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s protocol 2050 Construction of expression vectors To construct an miR-373-expressing...

Ngày tải lên: 14/03/2014, 23:20

... presentation of galectin-1-binding sites in p16INK4a-expressing cells and acquisition of anoikis susceptibility associated with the fibronectin receptor Induction of anoikis by galectin-1 In order to ... two changes with proven impact on its routing and binding activity The binding of b-galactoside-specific plant lectins intimated a new role, attributing to the integrin’s glycans the potential ... 3241 New function of p16INK4a ´ S Andre et al Besides using haptenic sugar to relate lectin activity to binding, we tested two mutants of human galectin-1 Their carbohydrate-binding activity was...

Ngày tải lên: 16/03/2014, 10:20