convert between an uno date and a basic date

... Reservoir area Watershed area Reservoir length Average depth Water capacity Effective capacity Yearly average inflow, outflow Hydraulic residence time Urban area in drainage basin Paddy area in drainage ... season All data Upper layer Wet season Dry season Middle layer Wet season Dry season Bottom layer Wet season Dry season All data at Jannge site Wet season Dry season All data at Jannge site Wet season ... organic matter when the portion of allochthonous organic matter become greater Most organic matter in water is being dissolved and consists of protein, carbohydrate, fat and humic substances and...

Ngày tải lên: 05/09/2013, 08:40

... b-turns and unordered regions of the individual intrinsically unstructured proteins and GFP moieties Analytical gel ltration and calculation of Stokes radii ă Gel ltration was performed on an AKTA ... ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA GGTTTTCGTCTAGAAGATTTCTGTC-3Â) designed to remove the NTAIL stop codon and to introduce a fragment encoding a TEV cleavage sequence and a NcoI restriction site at position ... (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction site at nucleotide position )6, whereas the reverse primer (5Â-ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC...

Ngày tải lên: 18/02/2014, 04:20

... excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy of the calculated sub-stomatal CO2 mole fraction (ci) On a chlorophyll ... remained constant and similar to the value recorded in control dark-adapted leaves, i.e 0.9 3.3 Stomatal response to ABA Stomatal responses to an application of exogenous ABA via the transpiration ... –CaMg and +Al–CaMg plants, gw at ca = 900 µmol mol-1 was significantly lower than in controls (–36%) Stomata of both +Al and –CaMg plants remained wide open with lowering ca On the other hand,...

Ngày tải lên: 08/08/2014, 14:22

... investigations revealed a right-to-left intracardiac shunt as a result of a patent foramen ovale (PFO) and a right atrial thrombus Case presentation A 21-year-old Caucasian woman with CF, rheumatoid arthritis ... normal The neurology resolved within 24 hours and a transient ischaemic attack (TIA) was diagnosed A transthoracic echocardiogram revealed a right atrial mass (there was no evidence of intracardiac ... patient was anticoagulated (international normalized ratio (INR) 2-3) Table Laboratory results FBC U&Es, LFTs PT, APTT, Fib Rheumatoid factor ANA Lupus anticoagulants Cardiolipin IgG/IgM Antithrombin...

Ngày tải lên: 11/08/2014, 14:20

... conditions, ATP demands are immediately increased Carbohydrate fuel, as an anaerobic substrate, has the advantage of having a fast degradation rate and can occur in the absence of oxygen for rapid ATP ... according to the manufacturer’s procedures BP, HR, and arterial oxygen saturation BP and HR were measured quietly and at constant temperature (~ 23°C) Participants were provided with an automated oscillometric ... the area under curve for glucose (GAUC change) and insulin (IAUC change) in the oldest-old subjects No correlation between GAUC change and baseline DHEA-S level was found ( 3A) ; IAUC change was...

Ngày tải lên: 31/10/2012, 16:49

Ngày tải lên: 05/08/2014, 09:46

... fistula between an abdominal aortic aneurysm and an aberrant renal vein: a case report Journal of Medical Case Reports 2010 4:255 Submit your next manuscript to BioMed Central and take full advantage ... (e.g Takayasu arteritis or giant-cell arteritis) are particularly at risk of developing an AAA People with diabetes and women are at lower risk of developing AAA [8] AAAs are often asymptomatic ... of AAA ranges between and 8% in men and is about 1% in women [6] Risks factors for AAA are male sex [7], smoking, age greater than 65 years and a positive family history Less important risk factors...

Ngày tải lên: 11/08/2014, 03:21

... fistula between an abdominal aortic aneurysm and an aberrant renal vein: a case report Journal of Medical Case Reports 2010 4:255 Submit your next manuscript to BioMed Central and take full advantage ... (e.g Takayasu arteritis or giant-cell arteritis) are particularly at risk of developing an AAA People with diabetes and women are at lower risk of developing AAA [8] AAAs are often asymptomatic ... of AAA ranges between and 8% in men and is about 1% in women [6] Risks factors for AAA are male sex [7], smoking, age greater than 65 years and a positive family history Less important risk factors...

Ngày tải lên: 11/08/2014, 07:20

... S-transferase M1, T, and P1 genotypes and rheumatoid arthritis J Rheumatol 2005, 32:992-997 Ghelani AM, Samanta A, Jones AC, Mastana SS: Association analysis of TNFR2, VDR, A2 M, GSTT1, GSTM1, and ... and KKB were involved in data acquisition, analysis and report drafting and provided final approval of the submitted manuscript LAC was involved in data interpretation and report generation and ... functional allele) Individuals with an absent or faint CYP 1a1 band (n = from VARA and n = 25 from SONORA) were excluded from further analyses, leaving available data from 703 VARA individuals and...

Ngày tải lên: 12/08/2014, 15:22

... Izmaylov, J Bloino, G Zheng, J L Sonnenberg, M Hada, M Ehara, K Toyota, R Fukuda, J Hasegawa, M Ishida, T Nakajima, Y Honda, O Kitao, H Nakai, T Vreven, J A Montgomery, J E Peralta, F Ogliaro, ... contributing factors in the stability of each structure was based primarily on geometric criteria, without a systematic evaluation of charge-transfer energies A statistical analysis of protein crystal structures[30, ... involving charge transfer from the S lone pairs to the CO p* antibonding orbital Altogether, these interactions add up to a total stabilization energy of more than kcal mol1, the largest of any of...

Ngày tải lên: 16/12/2012, 15:21

... organizational pyramid what shows you span of control, overall Child J (1988) Organization: A guide to Problems and Practice Paul Chapman Veeramuthu (2008) Organizations and Behavior, Hanoi: National ... Organization: A guide to Problems and Practice Griffin R.W., Organizational Behavior: Managing People and Organizations Houghton Mifflin Company 16 McCrae, R R and Costa, P T (2003) Personality in adulthood, ... is a proof for management’s talent of William H Gates and Steven A Ballmer although they have a different management way Have a question is given: What is the best way for management? There are...

Ngày tải lên: 12/04/2013, 21:50

... introduce a Also, Too And Another similar additional Besides Nor An additional idea ( and not”) Furthermore In addition Moreover And As As…as Likewise Both and Just as Like/ alike Similarly Not Too also ... intentional and habitual physical abuse It may also come in the form of sexual abuse and emotional abuse One partner may actively seek to degrade his/her partner through harsh language Drug and alcohol ... final]) When you are analyzing causes that are not of equal importance or that are immediate and remote, it is generally a good idea to organize the paragraphs beginning with the immediate and...

Ngày tải lên: 11/12/2013, 23:51

... Whereas in many countries and in the European continent, handshaking is done when meeting and departing day in and day out and even the same assortment of acquaintances, in England as well as Great ... than men are In Afghanistan, for example, men and women have their own ways of greeting strangers A man will greet by saying manda na bashi (may you not be tired) And a women will raise her hand ... introduced to a man who is at your age, what would you say and do? a How you do? b Please to meet you. and lightly embrace him c Please to meet you. And shake his hand d Say nothing and shake hand When...

Ngày tải lên: 24/12/2013, 09:36

... develop examinations which are relevant, fair and useful e they help the student to evaluate his/her performance and allocate his/her time more appropriately f finally, and just as important as any ... rarely conduct a needs analysis to find out what was necessary to actually achieve it Teachers nowadays, however, are much more aware of the importance of needs analysis, and certainly materials ... language information about the learners: what their current skills and language use are- present situation analysis- which allows us to assess (D) D The learners’ lacks: the gap between (C) and...

Ngày tải lên: 29/01/2014, 10:33

... thermogravimetric analysis (TGA), attenuated total reflectance (ATR) IR and ATR-near-IR),12 methotrexate (along with TGA),13 carbamazepine (along with FTIR and hot-stage FTIR thermomicroscopy),14 ranitidine ... performed at 52% and 100% relative humidity (RH) indicated that Form I formed a heptahydrate at typical laboratory temperatures and quickly became anhydrous above approximately 60–80 °C in a dry atmosphere ... Figures and 9) The lack of any additional peaks in the XRPD patterns would imply the presence of an Figure DSC of atypical anhydrous Form I (sample 11) amorphous material and/ or an impurity Note that...

Ngày tải lên: 14/02/2014, 03:20

... activity was evaluated as the difference between total activity and that measured in the presence of 100 lm vanadate (less than 10% of total activity at pH 7; less than 5% of total activity at pH ... interaction partner for the C-terminus of Arabidopsis thaliana plasma membrane H+-ATPase (AHA1 isoform): site and mechanism of action on H+-ATPase activity differ from those of 14-3-3 proteins Plant ... the plasma membrane H+-ATPase Plant Physiol 103, 391–398 Regenberg B, Villalba JM, Lanfermeijer FC & Palmgren MG (1995) C-terminal deletion analysis of plant plasma membrane H+-ATPase: yeast as...

Ngày tải lên: 19/02/2014, 07:20

... Freeman, and Yair Weiss, 2003 Understanding belief propagation and its generalizations, pages 239–269 Morgan Kaufmann Publishers Inc., San Francisco, CA, USA Fabien Cromieres 2006 Sub-sentential alignment ... sentence pairs extracted from a corpus of English/Japanese news We used 1000 sentence pairs extracted from pre-aligned data(Utiyama and Isahara, 2003) as a gold standard We segmented all the Japanese ... data with the automatic segmenter Juman (Kurohashi and Nagao, 1994) There is a caveat to this evaluation, though The reason is that the segmentation and alignment scheme used in our gold standard...

Ngày tải lên: 22/02/2014, 02:20

... "Peter, Paul and Mary gave a book, a pen and a pencil to Jane, Elisabeth and John respectively", we wish to associate a structural representation giving the 'meaning' "Peter gave a book to Jane, Paul ... in machine translation of natural languages, COLGATE Universit~ New York, August 1985 ACKNOWLEDGEMENTS [Zaharin 86] Zaharin Y "Strategies and heuristics in the analysis of a natural language ... well as a (manua$ reference for writing the linguistic programs (analysers and generators) in the machine translation system ARIANE-78 [Boitet-et-al 82] Relatively large scale Static Grammars have...

Ngày tải lên: 22/02/2014, 10:20

... proportionality because the mm NAD+ in a standard assay is well above Km and the 0.3% NAD+ contamination in mm NADP+ is far below Km Nevertheless, a rate  200 of the rate in a standard NAD+ reaction ... puried NADP+ in the enzymatic assays, and are displayed in the table Discrimination factors are calculated as the ratio kcat Km NAD+ kcat Km NADP+ NAD+ NADP+ Enzyme Km (mM) kcat (s)1) kcat Km ... mutant had values comparable with wild-type for kcat, particularly at pH 7.0 and 8.0 (Table 1) Decreases in catalytic efciency were due to increases in Km, approximately nine-fold at pH 7.0 and...

Ngày tải lên: 06/03/2014, 00:20

... Schindzielorz A, Okochi M, Leimer U, van Der Putten H, Probst A et al (2000) Subcellular localization of wild-type and Parkinson’s disease-associated mutant alpha-synuclein in human and transgenic ... to the parkinsonian neurotoxin MPTP Proc Natl Acad Sci USA 99, 14524–14529 43 Chandra S, Fornai F, Kwon HB, Yazdani U, Atasoy D, Liu X, Hammer RE, Battaglia G, German DC, Castillo PE et al (2004) ... to cause disease These mutations are associate with early onset of the disease and has the pathology includes LBs and is autosomal dominant [21] a- synuclein a- synuclein is a small (14 kDa), highly...

Ngày tải lên: 07/03/2014, 10:20