controlling the speed of a motor with a potentiometer
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... pulsating torque (the homopolar part) and a two-phase motor with a rotating field (the "ap" The classical Park transformation is, in fact, the succesion of two transformations The first trandormation...
- 8
- 517
- 1
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... results are however, in accordance with the results of Hasegawa et al [13] who questioned the paraphyly of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms ... NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific ... A/ H protected fragments were separated by PAGE and visualized by autoradiography RACE The cDNA for CYP11B2 of the guinea pig was amplified and cloned using a MarathonÒ cDNA Amplification Kit (Clontech)...
- 9
- 671
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... toroid, and is closely similar to that of the catalytic domain of A awamori and T thermosaccharolyticum glucoamylases, with the active site at the narrower end of barrel There is no terminal starch-binding...
- 11
- 548
- 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf
... scans are an average of three runs A mean residue weight of 115 was used for calculating the molar ellipticity values (A) Effect of warfarin on the near UV CD of HSA The concentration of HSA was ... characteristic of albumin to allow a variety of ligands to bind to it is amazing Albumin is the principal carrier of fatty acids that are otherwise insoluble in the circulating plasma Human serum albumin ... strengthening our argument that warfarin and genistein bind simultaneously and in the near vicinity of one another Daizepam, a characteristic marker ligand for subdomain IIIA (primary fatty acid...
- 17
- 457
- 0
Reducing the Risk of Breast Cancer With Medicine: A Guide for Women potx
... Learning About Breast Cancer Breast cancer is a malignant (muh-LIG-nent) tumor that starts with cells in the breast Malignant means that the cells are cancerous and may spread to other tissue in the ... breast cancer There is a chance that DCIS might become invasive cancer later on Invasive breast cancer With invasive breast cancer, the abnormal cells have spread beyond the place where they started ... If the cells are abnormal or cancerous, a biopsy may tell if they are still in one place or if they have started to spread Non-invasive breast cancer A non-invasive breast cancer is a growth of...
- 16
- 400
- 0
Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx
... TCC ACT CAG GT CCT CTG AAG GAG GCT GTG AT MMP9 NM_004994.2 TTG ACA GCG ACA AGA AGT GG CCC TCA GTC AAG CGC TAC AT IL-6 MN_000600.3 ATG CAA TAA CCA CCC CTG AC TAA AGC TGC GCA CAA TGA GA b-actin ... TGA CCA GGT TCT CCG AGG AG Reverse Primer CAC ACG TCG TAG CGG CAG TT TGFB1 MN_000660.3 GAC TAC TAC GCC AAG GAG GT GGA GCT CTG ATG TGT TGA AG PDGFA MN_002607.5 GGG AGT GAG GAT TCT TTG GA AAA TGA ... 67.3 years, age range 49 to 82 years) and 24 males (mean age 65 years, age range 40-76) All patients were classified as American Society of Anesthesiologists (ASA) physical status or Patients...
- 11
- 746
- 0
báo cáo hóa học: " Exploring disability from the perspective of adults living with HIV/AIDS: Development of a conceptual framework" docx
... *denominator of 15 interview participants only **13 identified themselves as African/African Caribbean/Black African/Black; Jewish; West Indian; Latin; Italian Canadian; Irish Canadian; French Italian; ... verbatim transcription and analysis Data management was facilitated using N6 computer software All participants completed a demographic questionnaire and the HIV Symptom Index [11] Page of 10 (page ... health-related challenges living with HIV, physical, social and psychological areas of their life affected, and how these challenges affected their overall health Over the course of the interviews and...
- 10
- 475
- 0
Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx
... execution (as in traditional motor learning), imitation, observation (as in observational learning) and motor imagery Activation of these brain areas following observation or motor imagery may thereby ... palms facing downwards, and faced the monitor at a distance of approximately 70 cm The image on the monitor showed a virtual arm in the same orientation and relative position as the real arms, ... hemisphere: diagram of the Δ[O2Hb] amplitude changes with standard error of the mean (SEM) and statistical significances of paired t-test are shown perhaps because they are less ‘automatic’ It has been...
- 13
- 577
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
... repeated measures For each gait parameter, a separate model was applied The dependent variable was the gait parameter and the independent variables were the group (patients or controls), the walking ... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently ... control group, the gait of the patients with a HLGD became more abnormal when they walked in near darkness There was no change in the average stride time when the patients walked in near darkness (p...
- 8
- 415
- 0
báo cáo hóa học: " Clinical implications of gait analysis in the rehabilitation of adult patients with "Prader-Willi" Syndrome: a cross-sectional comparative study ("Prader-Willi" Syndrome vs matched obese patients and healthy subjects)" docx
... show any change in sagittal plane knee moment [4] As far as obese adult patients are concerned, obese males display a gait pattern similar to healthy subjects but some of the temporal and angular ... Ospedale S Giuseppe" GA was comprised in the clinical assessment that all the ambulant patients have during the hospitalization The Lab was Page of (page number not for citation purposes) Journal ... sagittal plane was considered as the most important parameters for the analysis of articular mobility ROM was calculated as difference between absolute maximum (MAX) and absolute minimum (MIN) of the...
- 7
- 531
- 0
báo cáo hóa học: " Replication of the association of HLA-B7 with Alzheimer''''s disease: a role for homozygosity?" pptx
... interactions of HLA-B7 and HLA-Cw*0702 with other factors Table shows the associations of AD with HLA-B7 and HLA-Cw*0702 by APOE4 status Although the odds ratios were higher in APOE4 negatives than in ... tissues and between populations and degenerate Table 4: Associations of AD with HLA-B7 and HLA-Cw*0702 by APOE4 status Allele APOE4 status Proportions of alleles Controls Adjusted† odds ratios of AD ... disequilibrium, are associated with AD in the Oxford population Homozygotes may be at particular risk Although surprisingly, this is the largest study to date of the association of HLA-B & C alleles with AD,...
- 7
- 286
- 0
báo cáo hóa học:" The experiences of people living with HIV/AIDS and of their direct informal caregivers in a resource-poor setting" doc
... taught how to handle the people with HIV, because they are always laughing at them and insulting them When they are talking together and they see Majumdar and Mazaleni Journal of the International ... English Local research team members carried out translation and validation of the transcripts with the assistance of the translators Four members of the research team, two from Canada and two from ... as their primary source of medical assistance, participants also described a shortage of staff within the centre and an occasional shortage of medications According to one participant in a community...
- 9
- 425
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
... which generate estimates of the noise covariance matrix with more variance when primary data are used More precisely, the variance of the noise covariance matrix estimate and then the associated performance ... (called primary observation vectors) For example the secondary observation vectors may correspond to samples of data associated with another range than the range of the detected target in radar ... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers...
- 45
- 467
- 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx
... gar- The Clothes Make the Manager 41 ment bag If you want to make it a bit more interesting, you can buy a suit that has a weave or a minimal pattern that is either in the weave or in a ... suit can make a man look successful, sophisticated, and chic A pinstripe, a favorite of lawyers and investment bankers, can make a small man look tall or a chunky man look slim with soft wools A ... is a safe choice, or you can wear a larger pearl bead if you want to look more contemporary Also beware of pearls that are too tiny, because they can date you If you are on the other side of...
- 23
- 436
- 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx
... beautiful in our own way! Common Myths About Body Size The National Association to Advance Fat Acceptance (NAAFA) believes that people should be able to live large without being discriminated against ... but there are also plenty of lazy thin people All of our bodies have a different natural baseline size, and while food intake and exercise may contribute to changing this, there are also many other ... aren’t the stars; you are! Be careful not to create what I call a visual assault Examples of visual assaults include huge, gaudy pins, garish nail polish, appliqués on sweaters, a wild beard, spiky...
- 23
- 423
- 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc
... included Caucasians, A frican-Americans, Latinos, and Asians between the ages of 20 and 60 As expected, clothes and face topped the list, but I was surprised (and secretly pleased) that age came ... 11. False. The bread-and-butter plate should always be on the left side of the place setting above the fork The butter knife should be laid on the small plate diagonally Water and wine glasses are on the ... you, and use it Europeans also eat salads and cheese after their entrée European portions tend to be smaller than Americans are used to, so don’t complain to the waiter at a French restaurant that...
- 23
- 415
- 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 doc
... Be careful not to say “axe” instead of “ask,” “wif” instead of with, ” “tree” instead of “three,” “atha-lete” instead of “athlete,” or “talkin’” instead of “talking.” Speak clearly and say the ... like are the brain’s way of taking a nap If you need to pause to get your thoughts together, it’s better to say nothing at all than to hem and haw like a teenager YY Slang You don’t always have ... words and phrases are not a part of my regular business vocabulary: afraid can’t bad luck cheated blame crisis C an You He ar Me Now? 135 delay insist demand loss excuse must fail nonnegotiable...
- 23
- 416
- 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_6 doc
... frivolous topics are usually at ease with themselves and with others 17. False. Biting your lip when you speak shows a lack of confidence about what you are saying It also makes you appear less trustworthy ... you are feeling angry or vulnerable Either way, you are ready for a fight The 10 Percent Rule I learned about the 10 percent rule when I was a real estate agent It was said that agents lose a certain ... lose a certain percentage of sales, no matter how good they are, simply due to the law of averages Likewise, they will probably get a percentage of sales for the same reason I decided that this...
- 23
- 391
- 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_7 pptx
... take a percentage of your annual salary at the new job as a fee That said, it is also important to recruiters not to offer a candidate who will then turn around and refuse the job because of a salary ... briefcases Briefcases also should be conservative in color and always in top condition Stick to black or brown leather YY Carrying a backpack or fanny pack These kinds of totes are meant for casual ... out what you learned from them YY Make eye contact, and have a strong handshake YY Match the energy of the interviewer YY Stay calm if the interview isn’t going well; there will be others YY Avoid...
- 23
- 286
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25