configuring the wordpress mobile pack plugin as a theme switcher
Itzhak Perlman: a citizen of the word, with his violin as a passport
Ngày tải lên :
11/03/2014, 15:38
... For a few moments, close your eyes and imagine you are in a theater In front of us is the stage To the left, Itzhak Perlman sits in his chair, near the conductor The orchestra has already played ... the first two movements of Beethoven's D Major Concerto The violin leads us to the third, and immediately announces the major theme Listen now as Itzhak Perlman performs with the Philharmonia ... Orchestra of London Carlo Maria Giulini is the conductor (MUSIC) Our program was written and produced by Paul Thompson I’m Steve Ember Join us again next week for the VOA Special English program THIS...
- 2
- 400
- 0
Evaluating the Executive Director Your Role As a Board Member doc
Ngày tải lên :
24/03/2014, 01:20
... following list to prepare for and avoid these • Procrastination The board delays the evaluation for a meeting, then another, and then another… • Accentuating only the negative The board focuses only ... out a self-evaluation form that contains goals from the previous year’s evaluation The goals are a combination of organizational performance and individual improvement goals The chair then contacts ... performance is so closely associated with the performance of the organization, many boards choose to make the executive evaluation part of an annual cycle of broader organizational evaluation...
- 31
- 284
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
Ngày tải lên :
28/03/2014, 20:20
... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers ... post-testing, participants were asked to complete an additional questionnaire that asked them to rate several features of the program on a Likert scale They also completed a music questionnaire to determine...
- 19
- 648
- 0
The leg-to-body ratio as a human aesthetic criterion pdf
Ngày tải lên :
30/03/2014, 16:20
... repeated measure analysis of variance (ANOVA) with 71 participants was computed The sex of the stimuli and LBR were treated as within subjects factors, and participant gender was treated as a between ... of the arms was altered accordingly The legs were measured as the distance between the bottom of the feet and top of the pelvic region (above the hips and below the waist) The body was measured ... LBR was 1.0 Finally, the results also showed that there was no significant effect of participant gender, suggesting that both male and female participants were rating the images in the same manner...
- 7
- 408
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... unable to kill the APP-expressing neuroblastoma cells Taken together, these findings argue that the interaction of A with microglia and the assembly of the active microglial NADPH oxidase maybe...
- 12
- 413
- 0
Báo cáo khoa học: "Bioavailability of the amino acid-attached prodrug as a new anti-HIV agent in rats" pdf
Ngày tải lên :
07/08/2014, 23:22
... htob erusaem ot desu saw )ASU ,tneligA( nevo nmuloc a dna ,)ASU ,tneligA( relpmasotua na ,)ASU ,tneligA( ressaged a ,)ASU ,tneligA( pmup a ,)ASU ,tneligA( rotceted VU yarra edoidotohp a gnidulcni ... LA1050-PV rof alumrof eninala dica onima eht yb ytilibaliavaoib fo tnemevorpmi ehT etadidnac gurdorp wen a rof yrotcafsitas erew amsalp ni noitartnecnoc fo ecnanetniam eht dna ,mrof evitca na ... erew selpmas laireS )%2.0 noitartnecnoc lanif( tnalugaocitna na sa ATDE gniniatnoc ebut citsalp a otni )ASU ,nosnikciD-notceB( reniatucav a gnisu niev liat eht morf detcelloc erew selpmas doolb...
- 5
- 211
- 0
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
Ngày tải lên :
09/08/2014, 08:23
... International, Kanata, Ontario, Canada) was used as the ionizing radiation source The irradiator was calibrated with thermoluminescent dosimetry chips implanted in phantom mice The radiation ... manuscript AB assisted in drafting the manuscript, performed the in vitro work and molecular work, and assisted in the animal studies AS and AT performed the animal work and assisted in drafting the manuscript ... radicals and thus reducing indirect DNA damage As a measure of radiation-induced DNA damage, we evaluated induction of nuclear foci of phosphorylated histone H2AX (γH2AX), which has been established...
- 9
- 384
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
Ngày tải lên :
10/08/2014, 10:23
... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... Thomas was funded by the Wellcome Trust (GR0673790AIA) Bernard Croal was supported by a grant from Grampian Endowments Jeremy Grimshaw holds a Canada Research Chair in Health Knowledge Transfer and ... correlated for all the tests (Table 3) There was no evidence that perceived behavioural control was correlated with any of the other measures Multiple linear regression analyses demonstrated that attitude...
- 9
- 367
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
Ngày tải lên :
12/08/2014, 17:22
... 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and ... and then the COL 2A1 Forward: CAACACTGCCAACGTCCAGAT 62 Reverse: CTGCTTCGTCCAGATAGGCAAT MMP-3 Forward: TTTTGGCCATCTCTTCCTTCA 65 Reverse: TGTGGATGCCTCTGGGTATC ADAMTS- Forward: GACCTTCCGTGAAGAGCAGTGT ... CCTGGCAGGTGAGTTTGCAT ADAMTS- Forward: CCTGGCAGGTGAGTTTGCAT 60 Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated...
- 9
- 402
- 0
Báo cáo y học: "The self-organizing fractal theory as a universal discovery method: the phenomenon of life" pptx
Ngày tải lên :
13/08/2014, 16:20
... passing through them As an example, anaerobic bacteria and methanogenic archae form compact microbial granules that operate like an organ rather than a group Page 29 of 66 Kurakin Theoretical ... the same way as the pKa of an isolated amino acid and the pKa of the same amino acid embedded within protein matrix may differ dramatically, the redox behavior of chemical species isolated in the ... undirected, and thus, disruptive manner In the same way, but at the human scale, proactive members of an organization invigorate and drive the organization As a part of a mob, they inflame chaos and...
- 66
- 320
- 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
Ngày tải lên :
16/07/2015, 07:45
... the study Moreover, the research questions are also clearly stated to act the parameter for the whole paper I.1 RATIONALE A vast body of research has studied writing portfolios as a form of assessment ... i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... questions about educational mission and values are skipped over, assessment threatens to be an exercise in measuring what's easy, rather than a process of improving what we really care about (AAHE,...
- 65
- 893
- 7
The thai yellow shirts movement as a struggle for class recognition
Ngày tải lên :
06/10/2015, 21:07
... areas This was especially significant as their presence meant that they were no longer under a feudalistic-authoritarian state apparatus and more importantly, they say saw democracy as an accessible ... notes, was an attack on the Chatichai government that was seen as threatening the balance constituting the state and the political space More importantly, the coup represented also, the manifestation ... thesisʼs main conceptual contention – that “class” as a concept has been applied in an unproblematized and overgeneralized manner Many authors, as well as popular media and pundits, have tended to assume...
- 139
- 279
- 0
The thai yellow shirts movement as a struggle for class recognition
Ngày tải lên :
06/10/2015, 21:16
... areas This was especially significant as their presence meant that they were no longer under a feudalistic-authoritarian state apparatus and more importantly, they say saw democracy as an accessible ... notes, was an attack on the Chatichai government that was seen as threatening the balance constituting the state and the political space More importantly, the coup represented also, the manifestation ... thesisʼs main conceptual contention – that “class” as a concept has been applied in an unproblematized and overgeneralized manner Many authors, as well as popular media and pundits, have tended to assume...
- 139
- 480
- 0
The thai yellow shirts movement as a struggle for class recognition
Ngày tải lên :
06/10/2015, 21:23
... areas This was especially significant as their presence meant that they were no longer under a feudalistic-authoritarian state apparatus and more importantly, they say saw democracy as an accessible ... notes, was an attack on the Chatichai government that was seen as threatening the balance constituting the state and the political space More importantly, the coup represented also, the manifestation ... thesisʼs main conceptual contention – that “class” as a concept has been applied in an unproblematized and overgeneralized manner Many authors, as well as popular media and pundits, have tended to assume...
- 139
- 342
- 0
For king and country the thai yellow shirts movement as a struggle for class recognition 1
Ngày tải lên :
12/10/2015, 17:34
... have to at all A/ P Ganapathy, your passion for teaching and the students has been my inspiration as a TA Above all, thank you for writing the letter of recommendation in my application for Masters ... ʻclassʼ as a social category Thus, this thesis attempts to depart from the common conceptualization of the Yellow shirts as a ʻmiddle classʼ movement Conversely, it emphasizes an analytical framework ... have made the last two years a lot more enjoyable and bearable with the food, fun and laughter weʼve shared To the VCF postgraduate group and Mon CG, your prayers and fellowship have been greatly...
- 8
- 178
- 0
Speaking in two tongues an ethnographic investigation of the literacy practices of english as a foreign
Ngày tải lên :
04/12/2015, 14:05
... language and Cambodian young adult learners’ identity List of Abbreviations ALA Australian Leadership Award ASEAN Association of Southeast Asian Nations CELT Cambodian English Language Training ... left Cambodia for Australia as a recipient of a prestigious Australia Leadership Award (ALA) As an English-language user, teacher and teacher trainer with an applied linguistics background, I was ... defined as an autonomous and unique individual or is seen as inextricably and fundamentally embedded within a larger social network’ Among many traditional Asian and SouthEast Asian countries, the...
- 253
- 381
- 0
A study on the syntactic features of english and vietnamese lyrics adopting the functional grammar approach clause as a message
Ngày tải lên :
14/05/2016, 18:38
... “Mà” as Theme- Rheme boundary marker 4.2.2 Classification of Theme in Vietnamese 4.2.2.1 The classification of Theme into topical, interpersonal and textual Theme 4.2.2.2 The classification of Theme ... the sentence, called the Theme; the other is the semantic centre of the sentence, called the Rheme It always stands after the Theme “When people speak out a sentence they create a Theme and then ... a Theme E Predicated Theme F Theme in dependent, minor and elliptical clauses Dependent clauseas Theme Embedded clauses as Theme Minor clauses Elliptical clauses G Thematic equative 4.1.3 The...
- 13
- 781
- 1
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
Ngày tải lên :
26/10/2012, 10:03
... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... cases overwrite the codes when the information is updated Disability pension though, always has the higher priority In the present study we have analysed the determinants measured using the baseline ... health behaviour The third and final step introduced the psychosocial and physical work environment variables The Cochran-Armitage trend test was performed in order to test if a gradual increase...
- 6
- 578
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia by physicians to various ... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza ... transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the immune system...
- 4
- 520
- 0
Vcd as a stimulating factor to increase the young learners’ time-on-task
Ngày tải lên :
07/11/2012, 14:44
... for the past few decades So many approaches and methods such as Audiolingual Method, Total Physical Response, Content-based language teaching, Theme- based language teaching have been advanced, ... (2005), the oral-situational approach is based on a behaviorist learning theory, that is, it assumes that language learning is habit formation and over learning Grammatical structures are carefully ... teaching approaches: the oral-situational approach, the notional-functional approach, and the communicative approach, which are based on the three above language theories, respectively According...
- 45
- 516
- 0