click the drop down list arrow to the right of the apos at each change in apos box to display your column headings pick the heading according to which column you have used to sort the data
A dissertation thesis submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Departmentof History.
Ngày tải lên :
10/12/2016, 13:32
... finally, the overall level of success for the year Second, the level of detail is rather intense In the example above, the detail goes to the point of breaking down the cost of each aspect of ... amortization of the vine-dresser, the cost of maintaining him, and of fertilization, the hiring of casual labor, and all other current expenses It is interesting to find that the items which Columella ... great deal of acumen to detect in double-entry bookkeeping, in immature form, the ideas of gravitation, of the circulation of the blood, of the conservation of energy as well as other ideas which...
- 177
- 242
- 0
Tài liệu Báo cáo khoa học: High activity of human butyrylcholinesterase at low pH in the presence of excess butyrylthiocholine pptx
Ngày tải lên :
20/02/2014, 23:20
... kcat and bkcat At low pH (where the catalytic histidine is protonated), and in the presence of excess substrate, the binding of which induces a conformational change, cholinesterases use another ... conditions in which the catalytic histidine is protonated indicates a change in the mechanism of BuChE and AChE Work is in progress to probe the mechanism that could explain these observations Materials ... units, indicating that they are more than 90% complete by pH Therefore, the nonzero limiting rates for bkcat at low pH cannot be attributed to incomplete titration The data in Fig were in turn...
- 10
- 680
- 0
Get rich click the ultimate guide to making money on the internet slicer
Ngày tải lên :
03/05/2017, 15:15
... Can you replicate your success? Is your idea “scalable”? Are you relentless in your pursuit of profits? The top line is important but the bottom line is what you put in your pocket On the Internet, ... you the understanding that it’s not too late to score big on the Internet and motivates you to fire the pistol to hit yourself in the butt to take action And if you fire the shot correctly, the ... multinational company Using the Internet as the primary business model in your chosen market, often without maintaining a physical office or location other than your home office or a laptop Using...
- 384
- 503
- 0
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
Ngày tải lên :
07/09/2013, 13:00
... aware of the contribution of other factors involved in speaking 1.3 Cultural factors in the teaching and learning of speaking skills in classrooms 1.3.1 What cultural factors influence on the teaching ... want to teach the culture of the other country but because we have to teach it If we teach language without teaching at the same time the culture in which it operates, we are teaching meaningless ... teach a language without teaching a culture It means that teaching language is teaching culture Therefore, teaching culture has been integrated into language teaching programs and teaching materials...
- 38
- 1.2K
- 0
What is the question to which ‘substitution’ is the answer
Ngày tải lên :
01/11/2013, 10:20
... the other are understood as ontological categories Here the subject is not itself but other, to the point of standing in place of the other, of being substituted for the other Like the idea of ... sense of mine in the face of the other.5 Levinas thus introduces an account of how ethical action arises in the extreme passivity of obsession The relation to the other is now a bond rather than ... for another may strike the imagination of the poet precisely because it is but the play of the same: the negation of the I by the self is precisely one of the modes of identification of the I...
- 18
- 849
- 0
An analysis of errors related to the uses of english prepositions at, on, in produced by elementary level students at foreign languages & informatics center vinh city
Ngày tải lên :
18/12/2013, 10:04
... / in prison At church (attending church service) (prisoner) in the river / the lake / the sea / the at the seaside / at sea ocean at the top of the page / of + N 24 at the end of the road at the ... flexibility in conducting data gathering, research analysis and interpretation of gathered information In addition, qualitative method allows the presentation of the phenomenon being investigated in a ... 30) in (the field) at (Manchester) in (the ocean) on (the beach) in (the desert) in (the mountains) at (the post office) on (MK Street) on / at (the corner) in (the street) on (the island) in (the...
- 67
- 705
- 3
Tài liệu Biodiversity Response to Climate Change in the Middle Pleistocene ppt
Ngày tải lên :
17/02/2014, 20:20
... setting of the site as a context in which to interpret the fossil data; and relate the history of the discovery of Porcupine Cave, the spatial distribution and age of the fossil deposits, and the ... how the fossil information applies to understanding the effects of climatic warming on biodiversity The nature of the data makes it possible to examine how climate change affected biodiversity in ... north of the mine adit that now forms the entrance to the cave The geometry of the cliff face relative to the cave suggests that this crevice at some time may have opened into the cave It contains...
- 409
- 425
- 0
The National Road Map Strategic Plan To Accelerate Reduction of Maternal, Newborn and Child Deaths in Tanzania 2008 - 2015 potx
Ngày tải lên :
07/03/2014, 04:20
... and mainstreaming of MNCH indicators into policy frameworks The HMIS Unit will facilitate the monitoring of all indicators from routine data collection systems including community-based data through ... Examples of tools to be used include Plan Rep, costing tools and other relevant sources of information Strategic Output Indicator: Relevant sector (Ministry of Finance, MoHSW) allocating 15% of the ... maternal, neonatal and child indicators 5.2.6.2 Update monitoring data including FP and collection tools to include EmOC nutrition improved process indicators and other missing information on nutrition,...
- 102
- 488
- 1
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
Ngày tải lên :
07/03/2014, 12:20
... (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg) The resulting PCR fragments were subcloned into the entry vector pDONR201 (Invitrogen) using the GatewayTM Technology with help of a BP reaction (Invitrogen) ... (cggggtaccttattaagatccactatgatga tgatgatgatgatgatgct tatcgtcatcgtcc) The resulting PCR fragment was digested with NotI ⁄ KpnI and ligated into the NotI ⁄ KpnI sites of pFASTBac1 (Invitrogen) The primers ... determined again by incubating the activated CPU at 37 °C and using the same protocol as used in the primary screening described above Stable human CPU mutants Trizol (Invitrogen) according to the...
- 15
- 397
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
... * CLAP_1:ATTAGTGCTATAGTTTGGGAAATATTTAGCCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1797 CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT ... CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP_2:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT ... CLAP_1:AATTCGGCACGAGGCAAAAACAAATAAATGCTTAATTATGTTGTATATTATTCCATTATTTCTTATTATTGGCTGCTCAAATGCCATATGGATGTTAAAT CLAP_2:AATTCGGCACGAGG GCCATATGGATGTTAAAT M L Y I I P L F L...
- 12
- 772
- 0
Báo cáo khoa học: The involvement of human ribonucleases H1 and H2 in the variation of response of cells to antisense phosphorothioate oligonucleotides pot
Ngày tải lên :
08/03/2014, 10:20
... single band on these gels, as the ODN hybridizes to the center of the input target RNA The asterisk indicates the input target RNA; the arrow indicates the digested product bands The amount of ... susceptible to freezing or diluting of the extracts The extracts used in one experiment were always isolated at the same time and treated in the same way So within one experiment, the ratio of the extracts ... obtained is indicated at the bottom of the lanes as percentage of total signal detected in the lane (remaining uncut input RNA plus digested product RNA) Fig Northern blot analysis of the cell lines...
- 10
- 531
- 0
The National Road Map Strategic Plan To Accelerate Reduction of Maternal, Newborn and Child Deaths in Tanzania docx
Ngày tải lên :
14/03/2014, 09:20
... and mainstreaming of MNCH indicators into policy frameworks The HMIS Unit will facilitate the monitoring of all indicators from routine data collection systems including community-based data through ... Examples of tools to be used include Plan Rep, costing tools and other relevant sources of information Strategic Output Indicator: Relevant sector (Ministry of Finance, MoHSW) allocating 15% of the ... maternal, neonatal and child indicators 5.2.6.2 Update monitoring data including FP and collection tools to include EmOC nutrition improved process indicators and other missing information on nutrition,...
- 102
- 758
- 0
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
Ngày tải lên :
22/03/2014, 10:20
... Liver biopsy features including grade of steatosis, inflammatory infiltrate, and ballooning, the presence of Mallory hyaline, and stage of fibrosis were graded according to the scoring system proposed ... laboratory evaluation were performed in all patients at the time of first medical evaluation in our institution and repeated at regular intervals thereafter Laboratory evaluation included liver ... Hepatology index using Hospital Adaptation of International Classification of Diseases (HICDA) codes for fatty liver, hepatic steatosis or steatohepatitis (5710-42-42, 5710-43-1,...
- 7
- 487
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
Ngày tải lên :
23/03/2014, 05:22
... areas The first column of the questionnaire included the numbering of the Appendix of the REACH proposal so that the tests were grouped according to their subject (see appendix 1) Under the column, ... has to with the interest in including as many laboratories as possible It also took a lot of effort for the laboratories to compile the requested information We should mention that all of the ... factors, size of the testing lots, laboratory technology, and the organization of the laboratory One determinant on which we have information is the The outlier sheds as well light on three factors,...
- 19
- 493
- 1
Báo cáo khoa học: Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 pdf
Ngày tải lên :
23/03/2014, 10:21
... Discussion The binding of thyroid hormones is one of the main functions of TTR, which is functionally integrated with albumin and thyroxine-binding globulin as a network system to ensure the appropriate ... -e were introduced to indicate positions of residues in noneutherians Double underlining indicates amino acid residues located in the central thyroid hormone binding site For sources of the TTR ... recombinant TTRs as tetramers Analysis of binding to retinol-binding protein and thyroid hormones showed that the recombinant TTRs retained its function as binding protein for retinol-binding protein...
- 11
- 457
- 0
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
Ngày tải lên :
28/03/2014, 14:20
... deal with the choice of the doctor, the sources of information regarding the doctor, the reasons that led to them choosing that particular doctor, as well as the characteristics that the Greek ... the choice of the sex Indeed, studies have attempted to reveal a connection between the demographic information of the respondents and their preference of the sex of their doctor It seems that ... regarding the qualities of the sexes, and which in many cases influence the behavior of people in their social relationships According to the literature, the patients believe that a female gynecologist...
- 9
- 432
- 0