chuyên đề 4 phân tích kết quả kinh doanh

Giao trinh co so du lieu potx

Giao trinh co so du lieu potx

... a2 a3 a4 B b1 b2 b3 b4 C c1 c2 c3 c4 D d1 d2 d3 d4 Khi ú ni dung ca quan h r1 + r2 l: A x1 a2 x3 B y1 b2 y3 C z1 c2 z3 D v1 d2 v3 Giỏo Trỡnh C S D Liu A a1 a2 a3 a4 x1 x3 B b1 b2 b3 b4 y1 y3 ... Trang 42 Phongban(MAPB,TENPB,TRUSO,MANVPHUTRACH,KINHPHI,DOANHTHU) Mi phũng ban cú tờn gi phũng ban(TENPB), a im t tr s (TRUSO), mó nhõn viờn ph trỏch(MANVPHUTRACH), kinh phớ hot ng (KINHPHI), v doanh ... = {t r1 v t r2} Chng hn vi vớ d 2.2 thỡ r1 - r2 l: A a1 a3 a4 B b1 b3 b4 C c1 c3 c4 D d1 d3 d4 Giỏo Trỡnh C S D Liu Trang 22 2.3 .4. Tớch Decac ca quan h Cartesian Product) Cho hai lc quan h...

Ngày tải lên: 11/08/2014, 16:21

113 238 0
Thực trạng và giải pháp phát triển hệ thống cửa hàng tiện lợi Citimart B and B

Thực trạng và giải pháp phát triển hệ thống cửa hàng tiện lợi Citimart B and B

... Chương K0 840 711 54 Trương Văn Cường K0 840 71156 Nguyễn Quang Diệu K0 840 71159 Ngô Thị Dung K0 840 71161 Phạm Hồng Đức K0 840 71169 Đinh Xuân Đức K0 840 71171 Nguyễn Tú Hậu K0 840 71179 Phạm Minh Hoàng K0 840 71182 ... 2.3 Phân tích SWOT 10 2 .4 Chiến lược kinh doanh, tiếp thị 13 2 .4. 1 Tối đa hóa tiện lợi cho khách hàng 13 2 .4. 2 Xây dựng mối quan hệ thân thiết với khách hàng 14 2 .4. 3 ... K0 840 71183 10 Lục Minh Hồng Lĩnh K0 840 71197 11 Nguyễn Thị Lựu K0 840 71200 12 Nguyễn Bình Phương Minh K0 840 71203 13 Đặng Thị Kim Ngọc K0 840 71208 14 Phan Thế Nhân K0 840 71210 15 Lê Tiến Quân K0 840 71221...

Ngày tải lên: 01/04/2013, 11:40

29 1,2K 6
B and V Minimal Pair Quiz .doc

B and V Minimal Pair Quiz .doc

... show respect in Japan a bow b vow 13 Dust _ the surface of the coffee table a covered b cupboard 14 A feminist is not always a "women's _" a liver b libber 15 http://binhqx.violet.vn _ war was ... destination a Valley b Bali 13 It is important to _ you knees when you lift heavy objects a vend b bend 14 It is my solemn _ to help people in need I promise! a bow b vow 15 Love songs are often written ... charge of _ a rival b libel 13 A victory party is a time to _ in a team success a rebel b revel 14 First time sailors are derisively known as "land _" by seasoned veterans a lovers b lubbers 15...

Ngày tải lên: 25/08/2013, 08:10

12 445 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

... Endocrinology 144 , 5353–53 64 47 Neville DM (1968) Isolation of an organ specific protein antigen from cell surface membrane of rat liver Biochim Biophys Acta 1 54, 540 –552 FEBS Journal 277 (2010) 3735–3 749 ... regulation Biochem J 363, 41 7– 42 9 33 Corboy MJ & Draper RK (1997) Elevation of vacuolar pH inhibits the cytotoxic activity of furin-cleaved exotoxin A Infect Immun 65, 2 240 –2 242 3 748 34 Chiron MF, Fryling ... centrifugation as previously described [43 46 ] Plasma membrane was prepared according to the method of Neville [47 ] as described by Authier et al [43 ,48 ,49 ] The endosomal fraction was isolated...

Ngày tải lên: 18/02/2014, 04:20

15 588 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... al 42 43 44 45 46 47 48 protease resistance in recombinant and cellular PrP Effect of protein age and deamidation Biol Chem 275, 19121–19131 Tsenkova RN, Iordanova IK, Toyoda K & Brown DR (20 04) ... 3.0 3.5 4. 0 4. 5 5.0 -0.5 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4. 0 4. 5 5.0 -2 Variant pH7 -4 -0.5 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4. 0 4. 5 5.0 kcal/mole of injectant Molar Ratio -2 Variant pH5 -4 -0.5 ... 6000 40 00 2000 -40 00 -2000 -6000 -40 00 -8000 200 210 220 230 240 -6000 200 250 210 220 nm D 6000 deg·cm2–1·dmol 5000 P79S with Cu P79S without 240 250 40 00 6000 stA with Cu stA without 40 00 deg·cm2–1·dmol...

Ngày tải lên: 19/02/2014, 06:20

14 586 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... California Hepatology 46 :10 34- 1 040 ——— 2007b Why we should routinely screen Asian American adults for hepatitis B: A crosssectional study of Asians in California Hepatology 46 (4) :10 34- 1 040 Lok, A S., ... clearance Nature 46 1(7262):399 -40 1 Ghany, M G., D B Strader, D L Thomas, and L Seeff 2009 Diagnosis, management, and treatment of hepatitis c: An update Hepatology April 2009 (49 (4) ):1335-13 74 PREPUBLICATION ... Acute Hepatitis B Case Definition 41 BOX 2-3 CDC Acute Hepatitis C Case Definition 42 BOX 2 -4 CDC Chronic Hepatitis B Case Definition 43 BOX 2-5 CDC Hepatitis C Virus Infection...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... RA 644 .H4H37 2010 616.99 '43 6—dc22 20100031 94 Additional copies of this report are available from the National Academies Press, 500 Fifth Street, N.W., Lockbox 285, Washington, DC 20055; (800) 6 24- 6 242 ... Applications of Surveillance Data, 43 Outbreak Detection and Control, 44 Resource Allocation, 45 Programmatic Design and Evaluation, 45 Linking Patients to Care, 45 Disease-Specific Issues Related ... Recommendations, 2‑1 Role of Disease Surveillance, 42 2‑2 CDC Acute Hepatitis B Case Definition, 48 2‑3 CDC Acute Hepatitis C Case Definition, 49 2 4 CDC Chronic Hepatitis B Case Definition, 52 2‑5 ...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... Cerulean-elongin 34. 7 36.5 44 .8 43 .1 1.32 1.31 0. 94 0.93 5572 C-citrine(Y66A) C-citrine(Y66A)-elongin B C-citrine C-citrine elongin B ± ± ± ± a2 (%) 0.08 0.11 0.07 0.08 65.3 63.5 55.2 56.9 3 .47 3 .44 2.98 ... B-cerulean-citrine-elongin C 37.9 36.2 52 .4 44. 1 38.0 37.5 1.32 1.38 0.93 1.17 1.20 1.26 ± ± ± ± ± ± L- 62.1 63.8 47 .6 55.9 62.0 62.5 3. 54 3 .41 3.05 3.30 3.23 3.30 ± ± ± ± ± ± 0.08 0. 04 0.23 0.28 0.07 0.11 v2 ... Biophys Chem 127, 155–1 64 23 Rizzo MA, Springer GH, Granada B & Piston DW (20 04) An improved cyan fluorescent protein variant useful for FRET Nat Biotechol 22, 44 5 44 9 24 Bae JH, Rubini M, Jung...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... Advising the nation / Improving health 500 Fifth Street, NW Washington, DC 20001 TEL 202.3 34. 2352 FAX 202.3 34. 141 2 www.iom.edu The Institute of Medicine serves as adviser to the nation to improve health...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

... (1995) Inflammatory mediators increase surface expression of 850 K.-B Choo et al 37 38 39 40 41 42 43 44 45 integrin ligands, adhesion to lymphocytes, and secretion of interleukin in mouse Sertoli ... Rnf33 expression A TM3 F1 F1R4-2/3 – TNF-α + TNF-α F1MutκB 0.5 RLU 1.5 B + – – + – TM4 F1R4-1 F1R4-1MutB – – RLU C p50 p65 TNF-α – – – + TM4 ** * + – – + RLU – + – + TM4 + – + – – ** – – ** * + ... (Fig 4A, left-hand panel) Deletion of R4-2 or R4-3 alone (constructs F1R4-1 ⁄ and F1R4-1 ⁄ 2) did not appreciably affect luciferase activities relative to that of the parental F1 construct (Fig 4A)...

Ngày tải lên: 29/03/2014, 00:20

14 382 0
hepatitis b and d protocols volume 1

hepatitis b and d protocols volume 1

... Probesa No Designationb Sequence 10 11 12 13 14 15 143 4 + 144 5 + 145 4 + 146 4 + 148 5 − 1561 + 15 74 − 1590 − 1668 − 1678 + 1683 a 1752 + 1806 a 1808 a 18 24 − TCTCATCTGCCGGACCGTGT GGACCGTGTGCACTTCGCTT ... cloned HBV cDNA Assay J166 (50) b J166 (16) 19L27 9T40A f 9T41A f 144 5–1808+ (T)15c 144 5–1656+ 71bp d 143 4–1808+ (T)15 e 143 4–1808+ (T)15 144 5–1683+ (T)15 x DNA and xRNA tr RNA f RNA f RNA (control ... 1.37 M NaCl, 27 mM KCl, 43 mM Na2HPO4, 14 mM KH2PO4 (pH 7.3) Protease (Type XXXIV, Sigma) 50 mM Tris-HCl, pH 7 .4 (Fisher Scientific) PBS with 26 mM glycine (Sigma) 10 4% paraformaldehyde in PBS:...

Ngày tải lên: 11/04/2014, 09:45

333 404 0
hepatitis b and d protocols volume 2

hepatitis b and d protocols volume 2

... 0.2 47 .3 ± 3.3 47 .6 ± 4. 5 48 .0 ± 3.8 42 .4 ± 3.2 42 .6 ± 4. 5 43 .7 ± 3.6 37.8 ± 9 .4 20.6 nd 34. 2 35.6 nd PHA Control Acute Chronic 1.3 ± 0.1 1 .4 ± 0.1 1 .4 ± 0.1 6.9 ± 0.7 7.1 ± 1.0 6.9 ± 0.9 4. 9 ... on hepatocytes and lymphoid cells in chronic woodchuck hepatitis virus infection J Virol 74, 44 83 44 94 21 Yang, D L, Lu, M., Hao, L J., and Roggendorf, M (2000) Molecular cloning and characterization ... stored at 4 C; long-term storage should be performed at −20°C or −80°C 2.2 Solutions Phosphate-buffered saline (PBS): Dissolve g of NaCl, 0.2 g of KCl, 1 .44 g of Na2HPO4, and 0. 24 g of KH2PO4 in 800...

Ngày tải lên: 11/04/2014, 09:45

549 454 0
Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

... 64. 1 58 .4- 70.1 NS cells/μL 345 228 -44 7 333 223- 545 NS % thymic naive-Treg 4. 8 3.3-6.1 5 .4 4.7-7 .4 NS cells/μL 82 44 -123 62 44 -80 NS % cells/μL 2.0 1.5-3.0 4- 17 1.8 1.0-2.9 4- 11 NS NS CTL 22 .4 ... 0.0001 318-6 48 6 12 942 556-19 49 0 P = 0.0001 6.7 Average number 99 -44 8 763 /mL 3.8- 14. 1 4. 0 3.0 -4. 5 P = 0.003 P = 0.002 of B-cell divisions TRECs /106 PBMC 216 64- 949 3 74 8 34- 3 046 869 /mL 601-11 ... 10 980 24 680 11 360 950 -4 612 Haemoglobin (g/dL) 15.6 13 .4 14. 0 14. 2 14. 4 13.5 11.7 15.5 16.0 15.2 14. 5 14. 2 14- 18 Platelets (103/μL) 236 216 173 128 247 211 139 160 150 147 220 183 130 -40 0 b2-microglobulin...

Ngày tải lên: 18/06/2014, 16:20

7 560 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

... Tumor Type >2n >3n Total Cases AML 4. 6% 1.5% 14, 611 B-ALL 25.0% 2.0% 3,769 NHL - B-Cell NHL - T-Cell 14. 8% 7.2% 8.2% 5.1% 3, 542 1 ,49 7 Hodgkins 48 .8% 30.3% 244 T-ALL 5.9% 3.5% 1,130 Myeloma 39.8% ... mutations including T315I Blood 2008, 111 :43 55 -43 64 33 Walsby E, Walsh V, Pepper C, Burnett A, Mills K: Effects of the aurora kinase inhibitors AZD1152-HQPA and ZM 447 439 on growth arrest and polyploidy ... to sensitive cell lines in the panel (7.9% vs 1.2%, n = 28, p-value = 0.000 14, Unpaired t-test, 95%, CI 0.02 84- 0.1 044 ) (Additional File 1, Table S3) GSK1070916 Treatment Generates Polyploid Phenotype...

Ngày tải lên: 18/06/2014, 22:20

10 618 0
báo cáo hóa học: " Aspirin-triggered lipoxin A4 attenuates LPSinduced pro-inflammatory responses by inhibiting activation of NF-B and MAPKs in BV-2 microglial cells" pptx

báo cáo hóa học: " Aspirin-triggered lipoxin A4 attenuates LPSinduced pro-inflammatory responses by inhibiting activation of NF-B and MAPKs in BV-2 microglial cells" pptx

... http://www.jneuroinflammation.com/content/8/1/95 44 45 46 47 48 49 50 51 52 53 54 Page 12 of 12 epithelial cells through inhibition of nuclear factor-kappaB activation J Pharmacol Exp Ther 2010, 332: 541 - 548 Medeiros R, Rodrigues ... 2(-Delta Delta C(T)) Method Methods 2001, 25 :40 2 -40 8 Koistinaho M, Koistinaho J: Role of p38 and p 44/ 42 mitogen-activated protein kinases in microglia Glia 2002, 40 :175-183 Vaughn MW, Proske RJ, Haviland ... Wang JM: Activation of Toll-like receptor on microglia promotes cell 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 uptake of Alzheimer disease-associated amyloid beta peptide J Biol...

Ngày tải lên: 19/06/2014, 22:20

12 415 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

... Tumor Type >2n >3n Total Cases AML 4. 6% 1.5% 14, 611 B-ALL 25.0% 2.0% 3,769 NHL - B-Cell NHL - T-Cell 14. 8% 7.2% 8.2% 5.1% 3, 542 1 ,49 7 Hodgkins 48 .8% 30.3% 244 T-ALL 5.9% 3.5% 1,130 Myeloma 39.8% ... mutations including T315I Blood 2008, 111 :43 55 -43 64 33 Walsby E, Walsh V, Pepper C, Burnett A, Mills K: Effects of the aurora kinase inhibitors AZD1152-HQPA and ZM 447 439 on growth arrest and polyploidy ... to sensitive cell lines in the panel (7.9% vs 1.2%, n = 28, p-value = 0.000 14, Unpaired t-test, 95%, CI 0.02 84- 0.1 044 ) (Additional File 1, Table S3) GSK1070916 Treatment Generates Polyploid Phenotype...

Ngày tải lên: 20/06/2014, 04:20

10 665 0
Báo cáo hóa học: " Effect of Interfacial Bonds on the Morphology of InAs QDs Grown on GaAs (311) B and (100) Substrates" potx

Báo cáo hóa học: " Effect of Interfacial Bonds on the Morphology of InAs QDs Grown on GaAs (311) B and (100) Substrates" potx

... 10.1016/j.jcrysgro.2006.05. 046 17 B.A Joyce, D.D Vvedensky, Mater Sci Eng Rep 46 , 127 (20 04) doi:10.1016/j.mser.20 04. 10.001 18 S Sanguinetti et al., Europhys Lett 47 , 701 (1999) doi:10.1209/ epl/i1999-0 044 6-x 19 ... Res Lett (2009) 4: 689–693 Z.M Ye et al., J Appl Phys 92, 41 41 (2002) doi:10.1063/ 1.15 041 67 M.T Todaro et al., IEEE Photon Technol Lett 19, 191 (2007) doi:10.1109/LPT.2006.890 045 E.T Kim et al., ... doi:10.1103/ PhysRevB.68.165310 11 T Suzuki, Y Temko, K Jacobi, Appl Phys Lett 80, 47 44 (2002) doi:10.1063/1. 148 9087 12 K Jacobi, Prog Surf Sci 71, 185 (2003) doi:10.1016/S00796816(03)00007-8...

Ngày tải lên: 22/06/2014, 00:20

5 326 0
Báo cáo toán học: " Geometrically constructed bases for homology of partition lattices of types A, B and D" ppt

Báo cáo toán học: " Geometrically constructed bases for homology of partition lattices of types A, B and D" ppt

... bounded regions are labeled by their corresponding permutation x2=x3 x3=x4 x2=x4 x1=x3 x1=x2 13 24 12 34 21 34 31 24 32 14 23 14 x1=x4 Figure For type B, when the generic affine hyperplane H is chosen appropriately, ... basis for ˜ Hn−3 (Πn ); namely, the set of all ρω such that ω fixes n 31 24 3-1 24 3-1- 24 31- 24 3-12 -4 312 -4 31-2 -4 3-1-2 -4 Figure The partition lattice is the intersection lattice of the type A ... 3¯¯ < 057 | 1¯ ¯¯ 29 46 8 29 346 8, 057 | 1¯ | 3¯¯ < 057 | 1¯ ¯ ¯ 29 46 8 29 346 8 and 057 | 1¯ | 3¯¯ < 057 346 8 | 1¯ 29 46 8 29 the electronic journal of combinatorics 11(2) (20 04) , #R3 16 The poset...

Ngày tải lên: 07/08/2014, 08:22

26 288 0
Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc

Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc

... sCD40L IL-17 + sCD40L 1000 500 IL-6 (pg/ml) IL-6 (pg/ml) 2000 5000 Cell 40 00 IL-17 3000 IL-17 + nM SB203580 IL-17 + 10 nM SB203580 2000 1000 RA8 RA7 RA4 (b) 1500 Cell IL-17 IL-17 + PDCT sCD40L ... 127:539- 546 Katz Y, Nadiv O, Beer Y: Interleukin-17 enhances tumor necrosis factor α-induced synthesis of interleukins 1, 6, and in skin and synovial fibroblasts Arthritis Rheum 2001, 44 :2176-21 84 Alonzi ... LY2 940 02, wortmannin, and SB203580 were obtained from Calbiochem (Schwalbach, Germany), and pyrrolidine dithiocarbamate (PDTC) was from Sigma (St Louis, MO, USA) Soluble recombinant CD40L (sCD40L)...

Ngày tải lên: 09/08/2014, 01:23

9 412 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... cytochrome P450, catalyzes the synthesis of neurosteroids 7alpha-hydroxy dehydroepiandrosterone and 7alpha-hydroxy pregnenolone Proc Natl Acad Sci U S A 1997, 94: 4925 -49 30 20 21 22 23 24 25 26 27 ... early arthritis and classification of these patients two years later Arthritis Rheum 2001, 44 : 248 5- 249 1 Hamann J, Wishaupt JO, van Lier RA, Smeets TJ, Breedveld FC, Tak PP: Expression of the ... factors in rheumatic disease Arthritis Rheum 1999, 42 :609-621 Chang L, Karin M: Mammalian MAP kinase signalling cascades Nature 2001, 41 0:37 -40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated...

Ngày tải lên: 09/08/2014, 07:20

10 462 0
w