chromium vi reduction as a prerequisite for formation of dna damage
Heavy Metals in the Environment - Chapter 10 pps
... intake of Al-containing antacids for gastroduodenal ulcer disease (88) The results of this study provide no significant evidence that a large intake of Al in the form of antacids causes an increased ... provide an avenue for the transportation and intracellular deposition of Al Evidence for this pathway is provided in a report that Al accumulation was accompanied by an increase in iron uptake ... Yoshimasu, M Yasui, Y Yase, Y Uebayashi, S Tanaka, S Iwata, K Sasajima, DC Gajdusek, CJ Gibbs, Jr., KM Chen Folia Psychiatr Neurol Jpn 36:173–179, 1982 139 NI Ward, JA Mason J Radioanal Nucl Chem Art...
- 40
- 269
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... Gupta, A. K., Janssen, G.M & Banerjie, A. Y (1998) RNA polymerase of vesicular stomatitis virus specifically associates with translation elongation factor-1 alphabetagamma for its activity Proc Natl ... El’skaya, A. V (1997) Evidence for the formation of an unusual ternary complex of rabbit liver EF-1alpha with GDP and deacylated tRNA FEBS Lett 407, 13–17 31 Tatsuka, M., Mitsui, H., Wada, A. , Nagata, ... bidimensional PAGE by increasing its pI value should be associated with the presence of other post-translational modifications Methylation of eEF 1A has been significantly associated with SV40 transformation...
- 12
- 552
- 0
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt
... I kappa B kinase-beta: NF-kappa B activation and complex formation with I kappa B kinase-alpha and NIK Science 278, 866869 30 Rothwarf DM, Zandi E, Natoli G & Karin M (1998) IIKK-gamma is an ... also Paul Hayter, Sasha Sreckovic and Matthew Strawbridge with help in growing and analyzing the A5 49 cells and nally BBSRC for the award of a CASE studentship to AECI References Chakraborty AK, ... OPERA (Evotec, Hamburg, Germany) This assay study was also repeated with a glass at-bottomed ã 96-well plates (Whatman) and 4% formaldehyde xative Immunocytochemical analysis On reading a microplate...
- 13
- 475
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
- 16
- 462
- 0
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice 2
... CTC ATA GAG ATG CTC CG 3’ 5’ TCA AAG ACG ACG GCA TCC TCT ACC 3’ 5’ GTT CTC ATA GAG ATG CTC CG 3’ 5’ GCG GTG CAT GCC TTT AAT CTC A 3’ 5’ GAG GAG ATG GGG TGA GGA TT 3’ 5’ CAC ATC CTC CTG ACC TAC ... residues, and a MAPKK kinase (MAPKKK), which phosphorylates MAPKK on serine and activates it The best characterized MAPK pathway is the extracellular-signal regulated kinase (ERK) pathway The classical ... Grb2 and SOS resulting in Ras activation and initiation of the Ras/Raf/MEK cascade This pathway receives a primary signal from Ras-GTP, which binds directly to Raf-1, the MAPKKK in this cascade Activated...
- 132
- 329
- 0
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice
... receptor signaling Both adaptors act as negative regulators of Ras and mitogen activated protein kinase vi (MAPK), in particularly Extracellular signal-regulated kinases (Erk) Dok-1 and may exert ... hybridization Probe labeling Dephosphorylation of plasmid DNA Ligation of DNA Preparation of DH5α competent cells Transformation of DH5α by heat shock method Bacterial DNA mini-prep by alkaline ... Lck/yes-related novel tyrosine kinase Mitogen activated protein kinase Mitogen activated protein kinase kinase Mitogen activated protein kinase kinase kinase Major histocompatibility complex Macrophage...
- 16
- 229
- 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... activation of FX by G37 2A- FVIIa and FVIIa Values are means standard deviation FX S-2288 Enzyme kcat (ã 10)6 s)1) G37 2A- FVIIa FVIIa G37 2A- FVIIaặsTF FVIIaặsTF G37 2A- FVIIaặlipTF FVIIaặlipTF 49 ... involving Gly372 in factor VIIa E Persson and O H Olsen A B Fig PABA inhibition of G37 2A- FVIIa and FVIIa bound to sTF The residual amidolytic activity of G37 2A- FVIIa (d) and FVIIa (s), saturated ... monopegylated FVIIa (FVIIaPEG2k) was plotted as a function of time, a similar protective effect of sTF was observed for G372AFVIIa and FVIIa (Fig 4B) The apparent difference in the rate of pegylation of...
- 11
- 619
- 0
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
... lid part Experimental procedures Enzyme assay Glutaminase activity was assayed by determining the formation of l-glutamate by l-glutamate dehydrogenase, as previously described [12] The activity ... significant conformational change upon the binding of ligand [31] The smaller size of l-glutamine than the substrates for b-lactamase could be one of the reasons for the conformational changes of ... (pH 7.5) Bacillus glutaminase was purified using Q-sepharose (Tosoh, Tokyo, Japan) and hydroxyapatite (Wako, Osaka, Japan) The homogeneity of the final preparation of Bacillus glutaminase was confirmed...
- 11
- 521
- 0
Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot
... A, Koga R, Ogawa M, Kurano Y, Kawada J, Okada R, Hayashi YK, Tsukahara T & Arahata K (1996) Emerin deficiency at the nuclear membrane in patients with Emery–Dreifuss muscular dystrophy Nat Genet ... database searching, as follows (1) Multiprotease approach: the mass tolerance was set to ± 0.1 Da for both precursor mass and fragment ion mass Searches were performed in SwissProt without protease ... samples In sample (apparent molecular weight 35–45 kDa), LAP2, possibly the membrane isoform LAP c (38.5 kDa calculated, accession number AAH64677), was identified In sample (apparent molecular...
- 12
- 429
- 0
Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx
... and 5¢-GATGGGCACAGTGTGGGTGA-3¢; murine b-actin, 5¢-TGGAATCCTGTGGCATCCATGAAAC-3¢ and 5¢-TA AAACGCAGCTCAGTAACCGTCCG-3¢ Human GAPDH primers were included in the Advantage RT-PCR kit Immunoblot analysis ... Woodbridge, Ontario, Canada) Measurement of arginase enzymatic activity Arginase activity was measured by colorimetric assay [54] Cells (105) were lyzed in 50 lL 0.1% Triton containing lg antipain, lg ... infected with SeV (40 HAU per 106 cells) for the indicated times Cell lysates were analyzed for arginase activity A5 40 was measured, and arginase activity was determined as mUÆ(mg protein))1 This...
- 12
- 498
- 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
... Lipase Apolipoprotein AII Enoyl-CoA hydratase 3-Ketoacyl-CoA thiolase Perilipin GGTTGT gtagg AGTTCA AGGACA a AGGTCA AGGTAG a AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT ... monocytes and damaged vessel walls and plays a central role in the dynamic regulation of vascular haemostasis [23] Alterations in the level of TXA2, TXA2 synthase or the TXA2 receptor (TP) are widely ... is reasoned that PPARc agonists may help to alleviate the adverse cardiovascular events associated with diabetes mellitus [16,17] For example, PPARc activators inhibit matrix metalloproteinase-9...
- 20
- 432
- 0
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... immunoprecipitated for analysis of kinase activity GSK3 activity was expressed as a re-activation ratio (i.e GSK3 activity measured without PP 2A1 treatment divided by GSK3 activity after PP 2A1 treatment) Values ... statistical analysis was performed using one-way analysis of variance (ANOVA) followed by a Newman–Keuls post-test Data analysis was performed using GRAPHPAD PRISM software and considered statistically ... is also noteworthy that an analysis of the GS activity ratio in 3T3-L1 preadipocytes reveals that in unstimulated cells, basal GS activity was 80% lower than that measured in differentiated adipocytes...
- 10
- 804
- 0
Báo cáo " DENOTING THE NUCLEAR ISOTOPES IN EXPERIMENTAL GAMMA SPECTRUM" pptx
... informations of whole spectrum are expressed in a dynamical linked namelist, whose each component is a structure containing the infomations of an energy level The exhibit of the information of ... exactly the isotope However it is difficult to measure all energy levels of an isotope In this program, some specific energy levels are selected In C language, the database of each isotope is as ... isotopes are saved The energy and intensity of isotopes are the ones from the experimental spectrum They are able to different from the ones in the database as we explicated above The isotopes are also...
- 6
- 203
- 0
Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx
... 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢); SAE1 (sense, 5¢-GACCTGCTTCCCGATGACTTT-3¢ and antisense, 5¢-TTCCTCCAACCACAGCACATAC-3¢); UBC9 (sense, 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ ... 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ and antisense, 5¢-GCATCCGTAGCTTGAACAAGCCTC-3¢); PIAS3 (sense, 5¢-ACTGCAGGGACCCTGCTACA-3¢ and antisense, 5¢-CTTGATCAGTGCTCGGGAATG-3¢); PIASxa (sense, 5¢-TGCACCTCATTCACCGTCAT-3¢ and antisense, ... protease SENP2 were increased, whereas expression of E2 UBC9 and E3 ligases PIAS3 and PIASxb were reduced upon treatment with forskolin in rat granulosa cells for 24 h The changes of SUMO pathway...
- 12
- 443
- 0
FUTURE OF THE NUCLEAR SECURITY ENVIRONMENT IN 2015 pptx
... VICE ADMIRAL ASHOT A SARKISOV, Cochair, Russian Academy of Sciences (RAS) REAR-ADMIRAL VYACHESLAV M APANASENKO, Russian Academy of Rocket and Artillery Sciences EVGENY N AVRORIN, All-Russian Scientific ... nuclear materials in Russia Stories appeared in the Russian and foreign media about illegal sales of nuclear materials or transfers of these materials abroad Not all of these stories appeared realistic ... International Security and Arms Control), Tatiana Povetnikova, (Nuclear Safety Institute, RAS), Yuri Shiyan (RAS), and Olga Smyshlyaeva (Nuclear Safety Institute, RAS) We are also grateful to Tariq...
- 324
- 504
- 0
Báo cáo khoa học: The in vitro nuclear aggregates of polyamines pot
... migration at 37 °C of genomic DNA preincubated with ivNAPs and exposed to DNase I Whole genomic DNA and DNA fully digested by DNase I were used as controls (A) Lane 1: DNA + DNase I + l-ivNAP ... the DNA shielding, and promotes and assists the DNA conformational changes The ultimate result of the hierarchical self-assembly is the formation of organized polyamine–phosphate nanotubes that ... DNA + DNase I + H2O (11 lL) (B) Incubation of genomic DNA with DNase I in the presence of single polyamines Lane 7: DNA + DNase I + Spm (10 mM) Lane 8: DNA + DNase I + Spd (6.1 mM) Lane 9: DNA...
- 12
- 247
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... enzymatic activity of PC1 ⁄ has also been ascribed to a potential endogenous inhibitor, proSAAS [3] Enzymatically active PC1 ⁄ is generated via a series of irreversible proteolytic cleavages of ... polypeptide was characterized by western blotting, amino acid analysis and N-terminal Edman sequencing (data not shown) MS analysis showed that the isolated CT-peptide had a molecular mass within Da of ... was assessed but at more neutral pH As indicated in Fig 4, the only notable effect, namely an increase of enzymatic activity up to 50–60% and Fig The CT-peptide is able to increase the release...
- 10
- 305
- 0
báo cáo hóa học:" yuDetecting the percent of peripheral blood mononuclear cells displaying p-STAT-3 in malignant glioma patients" pot
... [1,2] STAT-3 has been found to be constitutively activated in 50-90% of all malignant tumors, including 53% of anaplastic astrocytomas and 53% of glioblastomas [3] In gliomas, cytokines, such as interleukin ... peripheral blood of patients withgliomas For subset analysis, after we became proficient at analyzing PBMC p-STAT-3, after the isolation of PBMCs as described above, additional aliquots of approximately ... significantly between healthy donors and glioma patients Abbreviations used: Anaplastic astrocytoma, AA; Anaplastic oligodendroglioma, AO; Glioblastoma multiforme, GBM; Normal, healthy donor, HD; Recurrent,...
- 9
- 462
- 0
Báo cáo sinh học: " Strategically examining the full-genome of dengue virus type 3 in clinical isolates reveals its mutation spectra" ppt
... GA TCT CTT CTT TGT CMT TCA CCA AAG AGT CTA GCT GGT CC CAT TGT GCG TCA ACA CTG CC AGC TGG CCA CTG AAT GAG G CAA AAG TCT TCC TAC TAA GTT G GCC GCA ATT TTC ATG ACA AAC AGC TAT CGT GGT GTT CC AAG ... d3999 1A d310688B AGT TGT TAG TCT RCG TGG TCC ARG CAC CTT CAG ATG AAC AWR TGC ACC CTC TGC ATK GCT CCT TCT TGR GGC AAG GGA AGC TTG GTG ACA TGC GC GGG AGT CTG CTT GGA ATT GCC ATT CTR GGW GAC ACC GCY ... were clearly observed and identified by close examination of the overlapping chromatogram files using the SeqMan program in the Lasergene software package (DNASTAR inc., Madison, WI) Special attention...
- 10
- 361
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25