choosing a folder to save in

A JOURNEY TO AMERICA IN 1834 pot

A JOURNEY TO AMERICA IN 1834 pot

... an appropriate prayer, alluding to our peculiar situation and praying for a safe voyage; and also those in the other parts of the vessel, also the Captain and family It was intended to have a ... out to promenade the deck Saw a ship yesterday The gale again increased[8] towards evening and I feared a poor night A very good pancake half way across the Atlantic SUNDAY, MAY 11TH Had a better ... Philadelphia (26-30) Philadelphia, by stage via Frankford and Schuylkill and steamer to Baltimore (30-34) Baltimore to Washington (34-36) Washington, by stage via Alexandria and Mount Vernon back to Washington...

Ngày tải lên: 06/03/2014, 12:21

117 500 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
drama a way to social inclusion

drama a way to social inclusion

... Portugal, Estonia and Finland The basic idea of the project was to connect participatory drama and informal learning Participatory drama methods were seen in project as a way to social inclusion.The ... Legioonateatterin opetukset – Kokemuksia ja ajatuksia ohjaajan ja kouluttajan roolista Kuikka, Suvi (toim.): Friikki Nuorisoteatteritoiminnan opas Vapaan Sivitystyön liitto Owens, Allan and Barber, ... Tiedostaminen ja muutos Paulo Freiren ajattelussa Systemaattinen analyysi sorrettujen pedagogiikasta Helsingin yliopiston kasvatustieteenlaitos, Helsinki Jauhiainen (1999): Ryhmäilmiö Koskela,Virpi...

Ngày tải lên: 23/05/2014, 19:18

168 1,2K 0
webbots, spiders, and screen scrapers [electronic resource] a guide to developing internet agents with phpcurl, second edition

webbots, spiders, and screen scrapers [electronic resource] a guide to developing internet agents with phpcurl, second edition

... 79 Storing Text in a Database 80 Storing Images in a Database 83 Database or File? 85 Making Data Smaller 85 Storing References to Image Files ... Page 18 Thursday, February 16, 2012 11:59 AM player to play multiple hands at the same table, while making it look like a separate person is playing each hand Imagine playing against a group of ... regular expressions and to know when, or when not, to use them Chapter 6: Automating Form Submission To truly automate web agents, your application needs the ability to automatically upload data to...

Ngày tải lên: 29/05/2014, 22:43

396 1,5K 1
dialogue editing for motion pictures a guide to the invisible art

dialogue editing for motion pictures a guide to the invisible art

... Gergana Vitanova, and Ludmila Marchenkova PART I: INVESTIGATIONS INTO CONTEXTS OF LANGUAGE LEARNING AND TEACHING Mastering Academic English: International Graduate Students' Use of Dialogue and ... actors within them Second, it locates learning in social interaction rather than in the head of the individual learner In learning a language, we appropriate signs that are laden with meaning, ... dialogism and speech genres in investigating how international graduate students in a North American program master the task of academic writing in English as a second language Arguing that dialogue...

Ngày tải lên: 01/06/2014, 00:54

255 349 0
a place to believe in locating medieval landscapes may 2006

a place to believe in locating medieval landscapes may 2006

... communal as well as individual memory The great hall at Yeavering may be seen or read as a memorial to preChristian warrior culture in this case a memory of a memory—or as a monument to Edwin’s gala ... geography Medievalists have already begun to incorporate spatial and new geographic perspectives into their r a place to believe in what it might mean to be ‘ in place’’—and his insistence on kinetic ... Overing Disclaimer: Some images in the original version of this book are not available for inclusion in the eBook library of congress cataloging -in- publication data A place to believe in : locating...

Ngày tải lên: 11/06/2014, 13:31

283 298 0
A guide to writing in economics

A guide to writing in economics

... writing 5 Part I Writing and Scholarly Argumentation Writing a Paper a Good Paper The Paper as a Whole Making Arguments: Claim, Reasons, Evidence—or, How to Ace that Essay Exam Making Economic Arguments ... empirical data are lacking, the available studies and accounts suggest that, in general, a flat tax is good for business Let’s add this, and a warrant, to our full argument: A flax tax should replace ... along 7 Adopt learning as a goal In our concern about grades, we often forget about one very important thing: learning Approach the writing assignment as a chance to learn: to learn about a subject,...

Ngày tải lên: 10/07/2014, 09:45

63 440 0
Describe a visit to an interesting exhibition ppt

Describe a visit to an interesting exhibition ppt

... radiant with joy On the walls, different patterns of modern paintings were hung: charcoal drawings, pencil drawings and oil paintings were on display Most of them reflect daily activities and ... An oil painting by Lu Tong Dao, one of the most famous artists in HCM city, portraying a scene at twilight in the country attracted my attention best: on a long and lonely road, a buffalo tender, ... imagination It brought me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings...

Ngày tải lên: 22/07/2014, 04:20

5 503 0
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx

Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx

... with a ratio of 1:4 [1] Table 1: Anatomical location of lymphomatous lymph nodes (n = 62) Anatomical location Number of cases Cervical Inguinal Axillary Intra-abdominal Supraclavicular Submandibular ... Perrotta N, Fantini A, Fabiano P, Monarca B, Basso N: Accuracy of laparoscopy in the diagnosis and staging of lymphoproliferative diseases World J Surg 2003, 27:653-658 Casaccia M, Torelli P, Cavaliere ... Panaro F, Nardi I, Rossi E, Spriano M, Bacigalupo A, Gentile R, Valente U: Laparoscopic lymph node biopsy in intra-abdominal lymphoma: high diagnostic accuracy achieved with a minimally invasive...

Ngày tải lên: 09/08/2014, 07:21

4 435 0
Báo cáo khoa học: "A model to estimate insulin sensitivity in dairy cows" doc

Báo cáo khoa học: "A model to estimate insulin sensitivity in dairy cows" doc

... MT, Obara Y, Itoh F, Hashimoto H, Takahashi Y: Non-insulinand insulin-mediated glucose uptake in dairy cows J Dairy Res 1997, 64:341-353 Perseghin G, Caumo A, Caloni M, Testolin G, Luzi L: Incorporation ... glucose disappearance after a GTT and it was suggested that the cows with a high body condition score were more insulin resistant than the thin- Table 1: Glucose, insulin and FFA in plasma and RQUICKI ... during lactation This would facilitate the use of RQUICKI as an index to identify changes in insulin sensitivity In humans obesity is related to a reduced insulin sensitivity concomitant with an...

Ngày tải lên: 12/08/2014, 18:22

3 316 0
Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt

Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt

... Davis S, Diringer MN, Skolnick BE, Steiner T; Recombinant Activated Factor VII Intracerebral Hemorrhage Trial Investigators: Recombinant activated factor VII for acute intracerebral hemorrhage ... continues to hemorrhage Administration of FVIIa is certainly warranted in this patient Life-threatening hemorrhage and coagulopathy in critical care patients carries significant morbidity and mortality, ... mortality, with increased incidence of respiratory failure and renal failure as well as multiple organ dysfunction FVIIa has efficacy in restoring hemostasis Additionally, early administration — before...

Ngày tải lên: 12/08/2014, 23:24

4 305 0
Global Telecommunications Primer A Guide to the Information Superhighway

Global Telecommunications Primer A Guide to the Information Superhighway

... 2.0% India** Growth NA NA NA NA NA 328 NA 881 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Indonesia Growth NA NA NA NA NA 563 NA 916 62.9% 763 -16.8% NA NA NA NA NA NA NA NA NA NA NA ... 1.0% India** Growth NA NA NA NA NA NA NA 0.1% NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Indonesia Growth NA NA NA NA NA 0.3% NA 0.5% 60.1% 0.4% -18.2% NA NA NA NA NA NA NA NA NA NA ... NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Indonesia Growth NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Korea Growth $59.2 $66.0 11.5%...

Ngày tải lên: 30/10/2014, 21:56

43 236 0
choosing a target journal and using its instructions to authors

choosing a target journal and using its instructions to authors

... Choosing a Target Journal and Using Its Instructions to Authors Barbara Gastel, MD, MPH Texas A& M University bgastel@cvm.tamu.edu Identifying a Target Journal • Decide early (before drafting ... instructions to authors before starting to prepare your paper • Consult the instructions while preparing your paper • Check the instructions again before submitting your paper Some Questions the Instructions ... May Answer • What categories of article does the journal publish? • What is the maximum length of articles? • What is the maximum length of abstracts? • Does the journal have a template for articles?...

Ngày tải lên: 26/03/2014, 14:08

10 243 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... in today’s marketplace to develop, maintain and use product branding to acquire a certain level of competitive advantage According to Ailawadi et al., (2003, p 1), this has led to various points ... service was good” In total, MacDonald achieved a higher overall mean value than Max hamburger In terms of standard deviation, we found out that MacDonald had a larger standard deviation than Max hamburger ... factors as ways to achieve brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are...

Ngày tải lên: 24/09/2012, 17:19

88 986 8
A to Z Intermediate part 1

A to Z Intermediate part 1

... the Marino family, Marina Calafa, Isabella Sbrana, Luca Belloni, Elisabetta Marchetti, Ilaria Merusi, Cristiana Toccafondo, Emanuela Ghisoifi, Luca Ferrami (musical inspiration), Luciana Fusar ... Gianluca Soria, Patrizia Caselli (and all at SIAS) Thanks also to LIST SpA for technological support, to International House in Pisa, in particular Chris Powell, Paola Carranza, Lynne Graziani ... (medical consultant), Giovanni Cozzi, Barbara Bargagna, Monica Ciampi, Paolo Bassi, Andrea Ceccolini, Carlo Bellanca, Claudia Rege Cambrin, Luca Zamboni, Sergio Marchetti, Guido Coli (and all at...

Ngày tải lên: 03/10/2012, 15:01

115 767 5
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... hematology analyzer (Beckman Coulter, Fullerton, CA, USA) To determine the CRP level, blood samples were drawn into green-top vacutainer tubes containing lithiumheparin as anticoagulant Plasma ... related to bacterial infectious diseases [19] In an experimental study, Bass and colleagues produced eosinopenia in rabbits and in humans using chimiotactic factors of acute inflammation [14] In ... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476...

Ngày tải lên: 25/10/2012, 10:35

10 598 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

... difficult to prove The case against swine in transmitting the avian influenza is not proven either One, how does an intestinal virus change to that of a respiratory airborne-virus that is adapted to ... which in turn infects mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and ... geographical demographics Sex and age both played a major factor in determining the susceptibility to the disease of the individual Females were stricken in rates greater than males, and young adults...

Ngày tải lên: 02/11/2012, 11:12

4 520 0
w