check the wiring harness between rear door speaker lh connector f 03 terminal 1 and 2
Land-based marine pollution and the Arctic - polarities between principles and practice
Ngày tải lên :
01/11/2013, 09:20
... Mammals, Vol 20 , 19 94, pp 11 9 20 29 A State of the Arctic Environment Report, p 16 1 Ibid., pp 16 5–8, 18 0 31 Text reprinted in ILM, Vol 38, 19 99, pp 1 UNEP (OCA)/LBA/IG .2/ 7, of December 19 95 See ... Report of the Conference of Official Representatives of the State Duma and the Government of the Russian Federation Dedicated to Approval of the National Plan of Action for the Protection of the Marine ... protection of the marine environment of the northeast Atlantic8 and the Baltic Sea area, respectively.9 Finally, efforts UN doc A/CONF .15 1 /26 , Vol 1, text reprinted in ILM, Vol 31, 19 92, pp 874ff F B Cross,...
- 25
- 469
- 0
Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx
Ngày tải lên :
16/02/2014, 15:20
... ˚ 2d2 (A2) R factor Wild-type CeMT -1 KO S S O S 4 3.3 2. 49 2. 53 1. 98 2. 52 0. 026 0. 017 0. 015 0. 013 74.3 48.6 40.5 O O 4 2. 00 2. 00 0. 010 0. 015 39 .1 30.9 CeMT -2 KO S 2. 48 0. 028 78.8 3.3 2. 51 1.98 ... to the histidine-rich site It is therefore likely that the difference in affinities for binding to the FEBS Journal 27 7 (2 010 ) 25 31 25 42 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 25 37 ... observed in spectra of the CeMT -1 knockout mtl -1 (tm1770) and the CeMT -1 A CeMT -2 KO Normalised signal CeMT -1 KO Wildtype 26 700 26 710 26 720 26 700 26 740 26 780 26 820 26 860 Energy (eV) B...
- 12
- 611
- 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
Ngày tải lên :
20/02/2014, 02:21
... giving the following empirical equation for kTS (Eqn 13 ) kTS ¼ 5:4 Â 10 5 ỵ 6 :2 10 3 ẵAdoMet2:9 322 :9 ỵ ẵAdoMet2:9 13 ị When the branch-point behaviour was simulated with Eqns ( 12 and 13 ) instead of the ... (illuminated leaf cell) RI AdoMet Cys Pi [CGS] [TS] JPhser 20 lM 15 lM 10 mM 0.7 lM lM lMỈs )1 )1. 55 0 .18 0.06 0.89 )0.7 0. 81 Jcystathionine RJThr I 0 .25 )0 .03 )0.007 )0 .1 0 .11 1 .03 Ó FEBS 2 003 An Arabidopsis ... presence of Pi considerably affects the dynamics of the system Indeed, in the presence of 10 mM Pi, the model indicates that the catalytic rates of CGS and TS are divided by a factor of and 11 , respectively,...
- 13
- 906
- 0
Health and Work of the Elderly: Subjective Health Measures, Reporting Errors and the Endogenous Relationship between Health and Work doc
Ngày tải lên :
05/03/2014, 21:20
... (1. 6) (1. 5) (1. 2) (1. 5) (0.3) (1. 2) (1. 0) (1. 8) (2. 3) (0 .2) (0.5) 14 76.64 3460 0.908 0.343 -0. 619 0.367 -0 .0 32 1. 122 -0.600 0.005 -1. 20 2 -0 . 12 8 0 .17 0 -0 .14 6 -0 .10 7 -0.390 -0.308 0.047 0. 003 1, 2 Absolute ... (2. 6) (1. 7) (2. 2) 15 43 .29 3460 1. 28 4 0.3 62 0 .20 8 0.3 21 -0. 019 -2. 327 -0.060 0.0009 0.465 0 .0 31 0 .17 1 -0.343 -0.0 92 -0.3 21 -0.333 -0.386 -0. 010 III 1, 2 (4.3) (1. 4) (0.8) (5.0) (3.7) (0 .2) (0 .1) ... (0 .1) (0.6) (0.5) (0.4) (1. 8) (1. 3) (1. 7) (1. 2) (2. 3) (3 .1) (0.5) (1. 6) 15 07 .19 3460 1. 0 71 0. 010 -0.454 0.558 -0 .0 31 -0.647 -0.058 0.0 01 0. 028 -0 .15 1 -0 .15 3 -0. 21 0 -0 .15 2 -0.488 -0.406 -0 .14 7...
- 23
- 538
- 0
Báo cáo khoa học: "Recognition of the Coherence Relation between Te-linked Clauses" potx
Ngày tải lên :
08/03/2014, 05:21
... Kurohashi and M Nagao 19 94 Automatic detection of discourse structure by checking surface information in sentences In Proceedings of the 15 th COLING, volume 2, pages 11 23 -11 27 G Lakoff 19 87 Women Fire, ... state W e use the infix notation for each function rather than prefix The square brackets identify the semantic structure of a clause and their subscripts denotes the surface ordering of the clauses ... Cause-Effect Means-End Additive Concession Contrast Total judgement by human(a) 89 75 64 45 3 28 0 output of program(b) 81/ 46) 83 (22 ) 48 ( 12 ) number of agreements(c) 79 63 48 34 28 0( 92) 22 9 58 (13 /...
- 7
- 339
- 0
The Harvard Classics Volume 38, by Various Copyright laws are changing all over the world. Be sure to check the copyright laws for your country before downloading or redistributing this pdf
Ngày tải lên :
22/03/2014, 23:20
... practitioners of this work Into whatever houses I enter, I will go into them for the benefit of the sick, and will abstain from every voluntary act of mischief and corruption; and, further, from the seduction ... come to the Pass of Suze, we found the enemy occupying it; and they had made forts and trenches, so that we had to fight to dislodge them and drive them out And there were many killed and wounded ... even with arquebuses And if there were four wounded, I always had three of them; and if there were question of cutting off an arm or a leg, or of trepanning, or of reducing a fracture or a dislocation,...
- 1.5K
- 611
- 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc
Ngày tải lên :
23/03/2014, 09:20
... spectrum of the DIM A from the wild-type strain at m ⁄ z 13 62, 13 76, 13 90, 14 04, 14 18, 14 32, 14 46, 14 60, 14 74, 14 88, and 15 02 (Fig 3C) The m ⁄ z value for each peak in this series is 16 mass units ... Km and 2% sucrose, and incubated at 39 °C PCR screening for disruption of Rv2951c was performed with a set of specific primers (29 51C; 29 51D; 29 51E; res1; res2) (Table 1) after extraction of the ... this study Gene Oligonucleotide Sequence (5¢- to 3¢) Rv2951c 29 51A 29 51B 29 51C 29 51D 29 51E 29 51L 29 51M ppsE1 ppsE2 ppsE3 ppsE4 res1 res2 GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC...
- 13
- 536
- 0
Buying a new car? Check the warranty before you sign… doc
Ngày tải lên :
23/03/2014, 10:20
... The code from the SMMT, who represent all sectors of the automotive industry in the UK, says that you are free to get your car serviced anywhere in the UK and still benefit from the manufacturer’s ... new car Aftersales costs, such as services, can represent around 40 per cent of the whole life cost of the car and many independent garages can offer the same quality of service as franchised ... substitute for them In law if the car develops a fault in the first six months, it will usually be assumed that the fault was there when you bought it In these circumstances you can ask the dealer...
- 6
- 306
- 0
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
Ngày tải lên :
29/03/2014, 08:20
... subsequent MALDI-TOF MS of the major protein bands (see Table S1) Additionally, FEBS Journal 27 7 (2 010 ) 11 59 11 71 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 11 61 Biochemical studies of NRPS domain ... + 14 .560 14 .567 14 .7 32 14 .776 14 .567 14 .5 51 74 .2 73.9 67.8 66.3 73.9 74.5 ± ± ± ± ± ± 0. 028 0. 023 0. 019 0. 017 0. 013 0. 015 volumes were 0 .17 2 ± 0 .034 mL for the apo-A-PCP and 0 .20 9 ± 0. 029 mL for ... of the Ppant thiol group Given a potential affinity of the aromatic fluorophore to the ATP-binding pocket, FEBS Journal 27 7 (2 010 ) 11 59 11 71 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 11 65...
- 13
- 493
- 0
Báo cáo khoa học: On the thermodynamic equilibrium between (R)-2-hydroxyacyl-CoA and 2-enoyl-CoAOn the thermodynamic equilibrium between (R)-2-hydroxyacyl-CoA and 2-enoyl-CoA doc
Ngày tải lên :
29/03/2014, 08:20
... sequencing of the genes of 2- hydoxyglutaryl-CoA dehydratase from 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Acidaminococcus fermentans Eur J Biochem 26 5, 404– 414 Hofmeister AE & Buckel W (19 92) (R)-lactyl-CoA ... derived from the measured equilibrium constant of 0. 017 (0 .1 kJỈmol )1) The absolute magnitude of the free energies of solvation of 1b and 2b are much larger than those of 1c and 2c, because of the ... than the values apparent from the measured à DGs a 2a 1b 2b 1c 2c H2O )4.4 )6.8 )43.7 )40.6 )16 .4 )2. 5 )24 .7 The calculated free energy of solvation (in kJỈmol )1) for x(g) à (1 molỈL -1) x(aq) (1...
- 9
- 400
- 0
Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx
Ngày tải lên :
29/03/2014, 09:20
... 19 , 17 21 17 26 23 50 26 Valtschanoff JG & Weinberg RJ (20 01) Laminar organization of the NMDA receptor complex within the postsynaptic density J Neurosci 21 , 12 11 12 17 27 Hall J, Hall A, Pursifull ... calculations The rmsd values for the 20 lowest-energy conformers of the best cluster are ˚ ˚ 0. 71 ± 0 .11 A for the backbone and 1. 11 ± 0.09 A for the heavy atoms The mean total energy of the ensemble ... binding site within the GRINL1A sequence B FEBS Journal 27 7 (2 010 ) 23 40 23 50 ª 2 010 The Authors Journal compilation ª 2 010 FEBS 23 41 ´ M F Garcıa-Mayoral et al DYNLL1 and GRINL1A interaction a cellulose...
- 11
- 474
- 0
Báo cáo khoa học: The evolutionary relationship between the duplicated copies of the zebrafish fabp11 gene and the tetrapod FABP4, FABP5, FABP8 and FABP9 genes pptx
Ngày tải lên :
30/03/2014, 04:20
... taf2 16 , 26 .70 16 , 31. 25 T 51 LN54 ATAD2 TAF2 8q24 .13 8q24 . 12 rad 21 has2 cdh17 edd1 eif3s3 16 , 16 , 16 , 16 , 16 , 61. 07 31. 67 46.90 67. 71 61. 23 LN54 T 51 T 51 T 51 HS RAD2 HAS2 CDH17 EDD1 EIF3S3 8q24 ... 8q24 . 12 8q 22 .1 8q 22 8q24 .11 mftc gdf6b spag1 zfpm2b 19 , 19 , 19 , 19 , 46.86 47.30 49.00 50 .25 LN54 HS T 51 HS MFTC GDF6 SPAG1 PTP4A3 8q 22. 3 8q 22 .1 8q 22. 2 8q24.3 rpl30 stk3 lyric1 azin1 angpt1 19 , ... Angiopoietin fabp11a fabp11b – – – – derl1 ndufb9 19 , 16 , – – – – 16 , 16 , 46.90 24 .20 LN54 LN54 – – – – LN54 T 51 – – FABP4 FABP5 FABP8 FABP9 DERL1 NDUFB9 – – 8q 21 8q 21 8q 21 8q 22 8q 21 8q24 .13 8q13.3 atad2...
- 10
- 293
- 0
at the boundaries of international trade and finance developing countries and the regulatory convergence between the international monetary fund and the world trade organization
Ngày tải lên :
03/06/2014, 00:55
... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without...
- 277
- 397
- 0
the valued relationship between workforce training and economic development a correlation study
Ngày tải lên :
03/06/2014, 02:17
... Hypothesis 1, Question 12 9 Table B5 Hypothesis 1, Question 13 0 Table C1 Hypothesis 2, Question 13 1 Table C2 Hypothesis 2, Question 13 2 Table C3 Hypothesis 2, Question 13 3 Table C4 Hypothesis 2, Question ... of the Study Rationale Research Questions and Hypothesis Significance of the Study Definition of Terms Assumptions 10 Limitations 11 Nature of the Study 11 Organization of the Remainder of the ... Categories and Responses 92 Table 17 Question Age Categories and Responses 94 Table B1 Hypothesis 1, Question 12 6 Table B2 Hypothesis 1, Question 12 7 Table B3 Hypothesis 1, Question 12 8 Table B4 Hypothesis...
- 155
- 414
- 0
báo cáo hóa học: " The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy" doc
Ngày tải lên :
18/06/2014, 19:20
... by ≥ 10 (N = 27 –39) 9 .1 (17 .0) 3.3 (16 .9) -0 .2 (15 .8) -1. 5 (14 .1) -13 .3 (19 .1) 2. 9 (24 .1) 0.7 (14 .2) 1. 8 (22 .8) -2 .1 (16 .0) 3.3 (19 .5) 1. 2 (16 .1) 2. 4 (19 .2) 2. 4 (17 .2) 5 .1 (20 .0) -1. 9 (18 .5) ... -4 .2 ( 21 . 2) -2. 0 ( 21 . 1) -1. 3 (10 .0) -1. 2 (9.5) -2. 9 (19 .7) -9 .2 (38.4) 1. 1 (25 .2) -2. 6 (24 .7) 0.4 (14 .4) -3 .1 (20 .5) -2. 7 (20 .1) -1. 6 (15 .5) -2. 2 (8.7) 0.3 (7 .2) -5 .1 (17 .9) -6.6 (46.0) -3 .1 (26 .4) ... Overall VFQ -25 score N Mean SD Range 670 6 71 6 71 6 71 6 71 6 71 670 670 6 32 665 669 6 71 69.5 89 .1 75.8 82. 9 93.9 77 .2 81. 4 91. 3 81. 1 94.6 88.4 84 .1 17.4 15 .2 21 . 7 17 .9 12 .9 21 . 3 23 .1 17.4 20 .7 14 .7 19 .4...
- 10
- 523
- 0
báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot
Ngày tải lên :
19/06/2014, 22:20
... Neurol 20 09; 40 :10 7 -11 2 21 - Mostafa GA, Shehab A The link of C4B null allele to autism and to a family history of autoimmunity in Egyptian autistic children J Neuroimmunol 2 010 ; 22 3 :11 5 11 9 22 - Mostafa ... Pharmacol Ther 20 09 ; 12 2( 2): 20 3 21 4 29 - Satake H, Kawada T Overview of the primary structure, tissue-distribution, and functions of tachykinins and their receptors Current Drug Targets 20 06;7(8):963– ... Relation to the disease severity Brain Behav Immun 2 011 ; 25 (7) :13 9 313 98 45- Ben-Ami SD, Blank M, Altman A The clinical importance of anti-ribosomal-P antibodies Harefuah 2 010 ;14 9 ( 12 ): 794-797 24 46-Mostafa...
- 30
- 522
- 0
báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot
Ngày tải lên :
20/06/2014, 16:20
... by ≥ 10 (N = 27 –39) 9 .1 (17 .0) 3.3 (16 .9) -0 .2 (15 .8) -1. 5 (14 .1) -13 .3 (19 .1) 2. 9 (24 .1) 0.7 (14 .2) 1. 8 (22 .8) -2 .1 (16 .0) 3.3 (19 .5) 1. 2 (16 .1) 2. 4 (19 .2) 2. 4 (17 .2) 5 .1 (20 .0) -1. 9 (18 .5) ... -4 .2 ( 21 . 2) -2. 0 ( 21 . 1) -1. 3 (10 .0) -1. 2 (9.5) -2. 9 (19 .7) -9 .2 (38.4) 1. 1 (25 .2) -2. 6 (24 .7) 0.4 (14 .4) -3 .1 (20 .5) -2. 7 (20 .1) -1. 6 (15 .5) -2. 2 (8.7) 0.3 (7 .2) -5 .1 (17 .9) -6.6 (46.0) -3 .1 (26 .4) ... Overall VFQ -25 score N Mean SD Range 670 6 71 6 71 6 71 6 71 6 71 670 670 6 32 665 669 6 71 69.5 89 .1 75.8 82. 9 93.9 77 .2 81. 4 91. 3 81. 1 94.6 88.4 84 .1 17.4 15 .2 21 . 7 17 .9 12 .9 21 . 3 23 .1 17.4 20 .7 14 .7 19 .4...
- 10
- 474
- 0
Báo cáo hóa học: " Binary Mixtures of SH- and CH3-Terminated Self-Assembled Monolayers to Control the Average Spacing Between Aligned Gold Nanoparticles" doc
Ngày tải lên :
22/06/2014, 00:20
... Manifar, A Rezaee, M Sheikhzadeh, S Mittler, Appl Surf Sci 25 4, 4 611 (20 08) doi :10 .10 16/j.apsusc .20 08. 01. 100 11 A Rezaee, K.K.H Wong, T Manifar, S Mittler, Surf Interface Anal (20 09) doi: 10 .10 02/ sia.3073 ... J.J Mock, D.R Smith, S Schultz, Nano Lett 3, 10 87 (2 003) doi :10 .10 21 / nl03 419 7f S Link, M.A El-Sayed, J Phys Chem B 10 3, 8 410 (19 99) doi :10 .10 21 / jp9 917 648 A Rezaee, A.K.A Aliganga, L.C Pavelka, ... Fischer, S Mittler-Neher, Thin Solid Films 340, 27 4 (19 99) doi :10 .10 16/S0040-6090(98) 013 66 -2 A.K.A Aliganga, A.S Duwez, S Mittler, Org Electron 7, 337 (20 06) doi :10 .10 16/j.orgel .20 06 .03. 013 10 ...
- 5
- 227
- 0