chapter 1 1 4 querying a reference

Tài liệu Chapter 1 - Living in a Network Centric World CCNA Exploration 4.0 pptx

Tài liệu Chapter 1 - Living in a Network Centric World CCNA Exploration 4.0 pptx

... such as: – Current and accurate training materials – Availability of training to a wide audience – Consistent quality of instruction – Cost reduction H c vi n m ng Bách khoa - Website: www.bkacad.com ... khoa - Website: www.bkacad.com A Scalable Network Architecture H c vi n m ng Bách khoa - Website: www.bkacad.com A Scalable Network Architecture H c vi n m ng Bách khoa - Website: www.bkacad.com ... mechanisms enable the establishment of queue management strategies that enforce priorities for different classifications of application data Examples of priority decisions for an organization...

Ngày tải lên: 12/12/2013, 14:15

41 730 0
Lab 4.1.4 Creating a Network Map using CDP

Lab 4.1.4 Creating a Network Map using CDP

... Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial ... router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 4- 4 CCNA 2: ... Serial (S1) 2500 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 2600 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 (FA0/0) (S0 /1) In order to find out exactly how...

Ngày tải lên: 04/11/2013, 16:15

4 505 0
Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

... range of clients that consultancy life brings The most gratifying aspect of my time at Haslimann Taylor has been watching a campaign snowball from regional to national, to international coverage ... break-out rooms, or at least beer fridges, and actively encourage evening socialising Jason Lees Account Executive Haslimann Taylor Law graduate “I chose a consultancy over in-house work because ... Account Manager Republic PR and Business graduate • Social Life – Having explored the various career and financial benefits of consultancy work, what you really want to know is the kind of social life...

Ngày tải lên: 13/12/2013, 04:15

2 683 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1 -4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... and salt stress signaling in Arabidopsis Mol Cell 15 , 14 1 15 2 FEBS Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 35 PTI1 -4, a common target of OXI1 and MAPKs ... Okamoto H, Knight H, Peck SC, Grierson FEBS Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS C Forzani et al 10 11 12 13 14 15 16 17 18 CS, Hirt H et al (20 04) ...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... 2002 49 86 R P de Vries et al (Eur J Biochem 269) Table Strains used in this study Strain Genotype Reference N402 NW200 cspA1 cspA1, bioA1, creAd4, pyrA13/pyrA+, areA1/areA+ cspA1, fwnA12, DargB/argB+, ... in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b -1, 4- endogalactanase, a construct ... hydroxide for 40 D-galactose, D-galactobiose and D-galactotetraose were used as standards to identify the D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Windows Controls (Chapter 1 - 4)

Windows Controls (Chapter 1 - 4)

... user click a button, a message box displays appropriately Exercise – Module Slide ImageList component (p .12 8)    ImageList is a component that allows you to organize groups of images ImageList ...  Add icons to ImageList control Set the SmallImageList, LargeImageList of ListView control With each item added to the ListView, set ImageIndex property of that item Example:  Page 11 0: create ... // panel1.Controls.Add(aButton); // add button to panel Exercise – Module Slide Creating event handlers at runtime (p .18 8)  Steps:    Exercise – Module Create a method whose signature matches...

Ngày tải lên: 13/05/2014, 12:19

27 154 0
asterisk gateway interface 1 4 and 1 6 programming sample chapter 4 a primer to agi asterisk gateway interface

asterisk gateway interface 1 4 and 1 6 programming sample chapter 4 a primer to agi asterisk gateway interface

... used for a regular AGI script: exten => _X. ,1, AGI(agi:/ /19 2 .16 8.2 .1: 1 048 /TestAGI|${EXTEN}|{VAR2}) In this scenario, the arguments are available via the AGI variables named agi_arg _1 and agi_arg_2 ... connected channel Removes database key/value Removes database keytree/value Gets database value Adds/updates database value Executes a given Application Prompts for DTMF on a channel Evaluates a channel ... DeadAGI and FastAGI AGI has three cousins—EAGI, DeadAGI, and FastAGI We shall now explain the use of each of these variants, and their proper usage EAGI—Enhanced Asterisk Gateway Interface EAGI...

Ngày tải lên: 05/11/2015, 08:33

22 494 0
unit 15 A 1-4

unit 15 A 1-4

... hay người khác từ đâu đến John Marie USA France Yoko Japan Lee China Minh Vietnam Name Country Nationality Language Minh Viet Nam Vietnamese Vietnamese Yoko Japan Japanese Japanese Lee China ... Chinese Bruce Australia Australian English Susan Laura Great Britain British Canadian Canada English English & French My name’s Minh Minh is from Viet Nam I’m from Viet Nam I speak Vietnamese Bruce ... Vietnam  Viet nam Australia  Úc France  Pháp China  Trung Quốc USA  Mỹ Japan  Nhật Britain  Canada  Anh Where is Laura from? are you She’s from Canada Laura Vietnam I’m Form: Where + be...

Ngày tải lên: 02/07/2013, 01:26

11 449 0
Tài liệu Anh 6 Unit 10: Lesson 1: A 1-4

Tài liệu Anh 6 Unit 10: Lesson 1: A 1-4

... ? - 'd like Nam Lan Hoa Tuan Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 *Practice: Ask and answer about Nam, Lan, Ba: S1: How does Lan feel? S2: She feels hot and thirsty S1: What would she like? ... 1: A1 -4/ p .10 4 -10 6 Free talk Eg: S1: Are you thirsty? S2: No, I am not S3: Are you cold? S2: No, I am not S4: How you feel? S2: I’ m hungry Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 Listen and repeat ... Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 Listen and repeat: I’m hungry a I’m thirsty b I’m hot d How you feel? We ’re full c I’m cold e I’m tired f Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 * Dialogue: Lan:...

Ngày tải lên: 30/11/2013, 01:12

21 775 0
Gián án Unit 10  - A.1-4

Gián án Unit 10 - A.1-4

... (to) want: muèn Wednesday, January 19 th 2 011 Unit 10 : A .1- 4 (P .10 4 -10 6) Listen and repeat What would you like ? Wednesday, January 19 th 2 011 Unit 10 : A .1- 4 (P .10 4 -10 6) Listen and repeat What would ... Lesson 1: A1 -4/ p .10 4 -10 6 Unit 10 : *Practice: A .1- 4 (P .10 4 -10 6) Wednesday, January 19 th 2 011 Make dialogues, using pictures - How does feel ? - is - What would like ? - 'd like Nam Lan Hoa ... like Nam Lan Hoa Ba Tuan Wednesday, January 19 th 2 011 Unit 10 : A .1- 4 (P .10 4 -10 6) Ask and answer about Nam, Lan, Ba: S1: How does Lan feel? S2: She feels hot and thirsty S1: What would she like?...

Ngày tải lên: 30/11/2013, 14:11

21 324 0
Bài soạn unit13 a 1-4

Bài soạn unit13 a 1-4

... õua I/Vocabulary: Win the prize(v): oaỷt giaới I/Vocabulary: -Take part in(v): Tham gia -Surprising(Adj): a ng ngaỷc nhión Vocabulary: - Skate boarding(n) : - Roller- Mọn trổồỹt vaùn Trổồỹt patin ... a/ What is the most popular sport in the USA? - Baseball b/ Which sport in at 11 th position? - Table tennis SPORT (Sport Baseball Skateboarding Roller-skating Rollerblading Basketball Football ... boarding(n) : Mọn trổồỹt vaùn I/Vocabulary: Roller skating(n) : Mọn trổồỹt patin I/Vocabulary: Baseball(n): Boùng chaỡy I/Vocabulary: Table tennis(n): Boùng baỡn START I/Vocabulary: Competition(n):...

Ngày tải lên: 03/12/2013, 19:12

26 279 0
CHAPTER 1 Microeconomics, A Way of Thinking about Business

CHAPTER 1 Microeconomics, A Way of Thinking about Business

... Brickley, Sanjai Bhagat, and Ronald C Lease, “The Impact of Long-Range Managerial Compensation Plans on Shareholder Wealth,” Journal of Accounting and Economics, vol (19 85), pp 11 5 -12 9 25 Y Amihud and ... coconuts and papayas to Harry We note that the cost of coconut to Harry is papayas; this is because he has to give up 24 papayas to produce coconuts If Harry can give up less than papayas for a coconut, ... Journal of Financial Economics, vol 20 (19 88), pp 4 31- 46 0; and J Warner, R Watts, and K Wruck, “Stock Prices and Top Management Changes,” Journal of Financial Economics, vol 20, pp 4 6 14 92 Chapter The...

Ngày tải lên: 17/12/2013, 15:18

44 503 0
Tài liệu Corporate finance Part 4- Chapter 1 pdf

Tài liệu Corporate finance Part 4- Chapter 1 pdf

... services 10 .5 9 .4 Electronics 10 .8 10 .3 Food retail 10 .9 10 .1 Other retail 11 — Media 11 .2 10 .2 Food and beverage 11 .5 10 .5 Luxury 12 10 .2 Utilities 12 .1 — Pharmaceuticals 12 .2 10 .9 Transportation 12 .8 ... À 4, 246 4, 428 1, 292 7,299 4, 713 4, 6 64 À3,928 7,0 71 5 ,18 8 4, 746 4, 2 24 6,7 21 5,0 51 4 ,10 1 505 6,639 5,3 04 4,306 868 6,703 5,622 4, 563 1, 093 6,8 24 5,987 4, 860 1, 255 7,052 6, 347 5 ,15 2 1, 2 34 7,0 64 ... 15 7,700 16 5,585 2 010 e 2 011 e 17 5,5 21 186,930 2 012 e 2 013 e 19 8 , 14 5 208,053 Assuming a risk-free rate of 5%, a beta of assets of 1. 1 and a risk premium of 5%, we find a WACC of 10 .5% You may also assess...

Ngày tải lên: 24/12/2013, 02:17

128 395 0
Tài liệu Seven Steps to a Successful Business Plan Chapter 1 pptx

Tài liệu Seven Steps to a Successful Business Plan Chapter 1 pptx

... Performance 211 Situational Analysis: The Bridge Between the Strategic Plan and the Operational Plan 213 Analysis of Company Performance 2 14 Analysis of Competition 215 Analysis of Market and Market ... associations, and other organizations For details, contact Special Sales Department, AMACOM, a division of American Management Association, 16 01 Broadway, New York, NY 10 019 Tel.: 212 -903-8 316 Fax: ... Appendix A: The Full Business Planning Model 357 Appendix B: The 1- Page Strategic Plan 3 61 Appendix C: The 1- Page Operational Plan 365 Appendix D: The 1- Page Organizational Plan 369 Appendix E: The 1- Page...

Ngày tải lên: 26/01/2014, 15:20

60 686 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... replication and expression (Fig 1) For the DNA alkylating reagent we chose the antibiotic (11 aS)-8hydroxy-7-methoxy -1, 2,3 ,11 a- tetrahydro-5H-pyrrolo[2,1c] [1, 4] benzodiazepin-5-one; (DC- 81) [1, 25] ... residue was dried under reduced pressure for h yielding as a mustard coloured solid (12 mg, 0. 0 14 mmol, 14 %) 1H NMR d 7.6–7.9 (m (16 H, P+–ArH and H -11 ), 7 .46 (1H, s, H-6), 6 .49 (1H, s, H-9), 4 .1 4. 2 ... mitochondrial protein )1 [47 ] or about 6 .1 · 10 14 basesÆmg protein )1, 19 .3% of which are guanines corresponding to 1. 18 · 10 14 guanine residuesÆmg protein )1 or about 200 pmol GÆmg protein )1 Therefore...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... l-galactono -1, 4- lactone but not l-gulono -1, 4- lactone [15 ] The other enzyme (ALO1) has a broader specificity and uses d-arabinono -1, 4- lactone [16 ], l-galactono -1, 4- lactone and l-gulono -1, 4- lactone ... Candida albicans D-arabinono -1, 4- lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L-galactono -1, 4- lactone dehydrogenase (GLDH), At3g47930;...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx

Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx

... by initial H-abstraction at C10 and 11 (E)-tetradecenoate to 9(Z) ,11 (E)-tetradecadienoate by initial oxidative attack at C9 [39] Whether these two transformations are catalyzed by separate enzymes ... the 1, 4- dehydrogenation of [8,82H2]-linoleate and [11 ,11 -2H2]linoleate Isotopic Ratio Substrates d0 : 8d2 a b Products d0 : 11 d2 d0 : 8d1 1. 95 2.08 2 .15 1. 72 KIE 6.99 4. 41 5.65 6.80 1. 07 1. 00 1. 09 ... 1. 07 1. 00 1. 09 1. 04 d0 : 11 d1 6.5 4. 4 5.2 6.5 (5.7 ± 1. 0) c 0.99 0.98 0.95 1. 19 (1. 03 ± 0 .11 ) 1. 93 2. 04 2.05 2. 04 c a The isotopic ratio of each species is given as an average value based on four...

Ngày tải lên: 08/03/2014, 09:20

6 341 0
UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 4. ELECTRONIC NETWORKING IN COMMUNICATION FOR DEVELOPMENTNOTE pptx

UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 4. ELECTRONIC NETWORKING IN COMMUNICATION FOR DEVELOPMENTNOTE pptx

... The table below summarizes some communication aspects of the hierarchical and participatory approaches HIERARCHICAL MODELS PARTICIPATORY APPROACHES Behavioural causes Structural causes Vertical ... their personal and professional goals, in ways that allow all stakeholders to learn about one another’s goals Multi-stakeholder planning also involves internal participants and external stakeholders ... traditional and/or appropriate media; • where accessible, these new media have features that enable bottom-up articulation and sharing of information on needs and local knowledge; • can increase...

Ngày tải lên: 08/03/2014, 20:20

20 272 0
w