chapter 9  life cycle of a project

Lecture Project management in practice - Chapter 5: Defining the scope of a project

Lecture Project management in practice - Chapter 5: Defining the scope of a project

... McGraw-Hill Education (Australia) Pty Ltd Pearson, Larson, Gray, Project Management in Practice, 1e 5-23 Change/Variation Control Management Copyright © 2013 McGraw-Hill Education (Australia) ... McGraw-Hill Education (Australia) Pty Ltd Pearson, Larson, Gray, Project Management in Practice, 1e 5-18 Example of a Work Package or ‘Pack’ Contents Copyright © 2013 McGraw-Hill Education (Australia) ... technical performance of the organisation on a project • Provides management with information appropriate to each organisational level • Helps manage plan, schedule and budget Copyright © 2013 McGraw-Hill

Ngày tải lên: 08/02/2020, 22:37

26 72 0
Lecture Discovering nutrition - Chapter 12: Life cycle: childhood through older adulthood spotlight on world nutrition

Lecture Discovering nutrition - Chapter 12: Life cycle: childhood through older adulthood spotlight on world nutrition

... fruits and vegetables – Important to reduce oxidative stress and degenerative diseases – May protect against damage to the brain Nutrient Needs of the Mature Adult • Minerals of concern – Calcium ... May interfere with food preparation and eating – Dietary changes may improve symptoms Nutrition-Related Concerns of Mature Adults • Bowel and bladder regulation – Increased risk of urinary tract ... Nutrition-Related Concerns of Mature Adults • Alzheimer’s disease – Affects ability to function – Reduced taste and smell – Risk for weight loss and malnutrition Meal Management for Mature Adults • Managing

Ngày tải lên: 20/01/2020, 17:43

36 38 0
Lecture Discovering nutrition - Chapter 11: Life cycle: maternal and infant nutrition

Lecture Discovering nutrition - Chapter 11: Life cycle: maternal and infant nutrition

... needs of any life stage – Carbohydrate and fat • Fat: major energy source • Carbohydrates as simple sugars – Water • More needed due to immaturity of organs • Human milk or formula satisfies ... Fetal stage: week to delivery • Growth Physiology of Pregnancy • Maternal Physiological Changes – Growth of maternal tissue • Adipose, breast, and uterine tissues – Increase in maternal blood ... Physiology of Pregnancy • Stages of Human Fetal Growth – Blastogenic stage: first weeks • Cells differentiate into fetus and placenta – Embryonic stage: weeks to • Development of organ systems – Fetal

Ngày tải lên: 21/01/2020, 11:39

55 48 0
Risk adapted approach: How to treat splenic marginal zone lymphoma in resource-poor settings? - The real-life experience of a Brazilian cancer treatment center

Risk adapted approach: How to treat splenic marginal zone lymphoma in resource-poor settings? - The real-life experience of a Brazilian cancer treatment center

... splenic marginal zone lymphoma Haematologica 2010;95(10):1792–6 Murakami H, Irisawa H, Saitoh T, Matsushima T, Tamura J, Sawamura M, Karasawa M, Hosomura Y, Kojima M Immunological abnormalities ... after the third year Pádua Covas Lage et al BMC Cancer (2020) 20:717 Statistical analysis The univariate analysis to assess the association among categorical variables was performed using MantelHaenszel ... Funding No funding was received Availability of data and materials All data generated and analysed during this study are included in this published article The raw data that generated the results

Ngày tải lên: 19/09/2020, 21:58

12 27 0
LIFE CYCLE OF MACHINE LEARNING

LIFE CYCLE OF MACHINE LEARNING

... 01 LIFE CYCLE OF MACHINE LEARNING learn.machinelearning @learn.machinelearning 02 learn.machinelearning What is ML lifecycle? Machine Learning Life Cycle is defined as a cyclical process which ... three-phase process Data, Training phase, and Inference phase acquired by the data scientist and the data engineers to develop, train and serve the models using the huge amount of data that are involved ... There are various KPIs available in the Machine Learning area for testing the accuracy and performance of a model which can vary on the basis of models Model Deployment Trained Model has to be

Ngày tải lên: 09/09/2022, 19:59

10 2 0
The ASSISTment Builder Supporting the Life Cycle of ITS Content Creation

The ASSISTment Builder Supporting the Life Cycle of ITS Content Creation

... each instance of the ASSISTment created Figure Generation of variables Each variable has a name and a value Here all the variables are said to belong to a set Once variables have been generated ... hints, and buggy messages, this implementation allows a broad use of variables Each variable associated with an ASSISTment has a name and one or more values These values may be numerical or may include ... correctly generated and used, and alerts the content creator to any mistakes The main advantage of variabilization lies in the fact that once a template variabilized ASSISTment is created, new ASSISTments

Ngày tải lên: 18/10/2022, 07:07

19 0 0
Life Cycle of Digital Ref Sources Farmer

Life Cycle of Digital Ref Sources Farmer

... who asks for a Russian database for his student population of ten may need to rely on interlibrary services For that reason, academic librarians also need to assess the availability of digital ... with a price Some professionals have a hard time trusting vendors to select, deselect, and manage on behalf of academic librarians Academic catalogers are likely to assert that outsourcing has ... not have a link to a statement please ask when they anticipate compliance or when they anticipate having a Web based statement Must additional software be installed in order for this database

Ngày tải lên: 23/10/2022, 21:05

21 0 0
Life cycle of the salmon

Life cycle of the salmon

... also has disadvantages in cost and time These are three main kinds of transportation until now Transportation on land is suitatble for short and average distance It is also the most popular and ... years them immigrate to the river in a spawning season What are cause and effect of Corona virus outbreak? In a first half of year 2020, the whole world has faced to a huge issue called Corona ... convenient ways in moving Airway and water transportation are suitable for long distance Whatever kinds of transportation you use, you should alway stay alert to protect you self because risk can come

Ngày tải lên: 30/03/2023, 15:20

15 1 0
Presentation life cycle of oil and gas (1)

Presentation life cycle of oil and gas (1)

... oil and NGLs and total liquids production, cash flow, net debt, and cash balance as of year-end); 2012 projected net debt and cash balance as of year-end; projection for long-term natural gas ... natural gas and liquids based on NYMEX $3.25 per Mcf and WTI of $95 per bbl, an estimated U.S./Canadian dollar foreign exchange rate of $1.00 and a weighted average number of outstanding shares ... grain of sand Federal Land “Grab” • The BLM manages nearly 700 million acres of mineral estate This acreage includes areas where either the BLM or other federal agencies manage the surface, as

Ngày tải lên: 31/03/2023, 11:45

71 3 0
Life cycle of the salmon

Life cycle of the salmon

... also has disadvantages in cost and time These are three main kinds of transportation until now Transportation on land is suitatble for short and average distance It is also the most popular and ... years them immigrate to the river in a spawning season What are cause and effect of Corona virus outbreak? In a first half of year 2020, the whole world has faced to a huge issue called Corona ... convenient ways in moving Airway and water transportation are suitable for long distance Whatever kinds of transportation you use, you should alway stay alert to protect you self because risk can come

Ngày tải lên: 01/04/2023, 10:47

15 4 0
Application of geophysical methods in a dam project: Life cycle perspective and Taiwan experience

Application of geophysical methods in a dam project: Life cycle perspective and Taiwan experience

... dam safety assessments Area Name of the dam Aim of investigation Applied geophysical method Reference Asia Asia Asia Asia Asia Asia Asia Asia Asia Asia Asia Asia Asia America America America America ... America America Europe Europe Europe Europe Europe Europe Europe Shuishe Dam Hsinshan Dam Wushantou Dam Shigang Dam Xishi Dam Sandong Dam Unkonwn Dam in Korea Afamia B Dam Som-Kamla-Amba Dam Nanshui ... curtain) Abnormal seepage in downstream shell Abnormal seepage in dam body Abnormal seepage in dam foundation Cracks in dam body Abnormal seepage in downstream toe Abnormal seepage in dam body Abnormal

Ngày tải lên: 22/03/2023, 10:51

11 0 0
Solid Waste Management and Greenhouse Gases A Life-Cycle Assessment of Emissions and Sinks potx

Solid Waste Management and Greenhouse Gases A Life-Cycle Assessment of Emissions and Sinks potx

... NA NA -0.37 NA NA -1.84 NA NA -1.84 NA NA 0.00 NA NA -2.22 NA NA -2.22 NA NA NA NA NA NA NA NA NA -3.99 -55.47 -0.28 NA NA -13.97 NA NA NA NA NA NA NA -3.99 -55.47 -0.28 NA NA -13.97 NA NA NA ... NA NA NA NA NA NA 0.00 0.00 0.00 NA NA 0.00 NA NA NA NA NA NA NA 0.00 0.00 0.00 NA NA 0.00 NA NA NA 0.00 0.00 0.00 NA 0.00 0.00 0.00 NA NA 0.00 NA NA NA NA NA NA NA -3.99 -55.47 -0.28 NA NA -13.97 ... Mixed MSW (as disposed) NA NA NA NA NA Carpet -3.99 0.00 NA NA NA Personal Computers -55.47 0.00 NA NA NA Clay Bricks -0.28 0.00 NA NA NA Concrete NA 0.00 NA NA NA Fly Ash NA 0.00 NA NA NA Tires

Ngày tải lên: 31/03/2014, 13:20

170 1K 0
A Companion to the History of Economic Thought - Chapter 9 docx

A Companion to the History of Economic Thought - Chapter 9 docx

... 78) James Hunt, the influential owner of the Anthropological Review, also repeatedly attacked race-neutral accounts of human nature: “Mr. Mill, who will not admit that the Australian, the Andaman ... that their gratification can be a motive to steady and regular bodily and mental exertion If the negroes of Jamaica and Demerara, after their emancipation, had contented themselves, as ... the tradeoff between sex and material income She found in America an instance in which a man can have more of both sex and material income by acquiring additional families, only one of which

Ngày tải lên: 06/07/2014, 02:20

18 458 0
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

... that the formation of these foci is dependent on active retroviral integrase, and HDAC4, but not HDAC2 and HDAC6, associates with viral DNA Taken together, these data indicate that HDAC4 plays ... demonstrate that the histone deacetylase HDAC4, a Class II HDAC, associates with DNA of HIV-1-based vectors and forms foci at sites of integration We also show that overexpression of nuclear HDAC4 ... immunoprecipitated with antibodies against HDAC2 and HDAC6, as indicated Terminology as above, * indicates samples from A (C) Effect of an integrase inhibitor on the association of HDAC4 with vector DNA Cells...

Ngày tải lên: 12/08/2014, 01:21

10 386 0
Lecture management  a pacific rim focus   chapter 9  basic elements of organisational structure

Lecture management a pacific rim focus chapter 9 basic elements of organisational structure

... McGraw-Hill Australia Pty Ltd PowerPoint Nature of organisational structure Formal pattern of interactions and co-ordination designed by management to link the tasks of individuals and groups in achieving ... McGraw-Hill Australia Pty Ltd PowerPoint Types of departmentalisation Departmentalisation: Clustering of individuals into units and units into departments and larger units to facilitate achievement ... achievement of organisational goals • Functional • Divisional • Hybrid • Matrix © 2003 McGraw-Hill Australia Pty Ltd PowerPoint Types of departmentalisation Functional: Functional:based basedon on...

Ngày tải lên: 22/05/2016, 14:24

21 375 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

... show a high level of satisfaction, a lack of standard satisfaction scales and the proliferation and excessive use of surveys (Altany, 1993; Mehta, 1990) Additional problems mentioned are haphazard ... the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) (see ... Van Nostrand Reinhold New York Kujala, J., Ahola, T., (2003) A Conceptual Framework for Analyzing the Value and Role of Customer Satisfaction Surveys: An Application to Project- oriented Organization,...

Ngày tải lên: 15/01/2014, 15:59

37 1,1K 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

... generated from first-strand cDNA and the following primers (NKA48, accession number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢GCCTTCTAATACGACTCACTATAGGGACCACGATG ... 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting DNA spanning nucleotides 21–536 of the ... each of the following primers For NKA8: forward, 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢ For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG...

Ngày tải lên: 07/03/2014, 12:20

10 639 0
ANNALS OF THE NEW YORK ACADEMY OF SCIENCES - Full cost accounting for the life cycle of coal potx

ANNALS OF THE NEW YORK ACADEMY OF SCIENCES - Full cost accounting for the life cycle of coal potx

... risk.86 Particulates are a cause of lung and heart disease, and premature death,83 and increase hospitalization costs Diabetes mellitus enhances the health impacts of particulates87 and has been ... destabilize underground faults and lead to earthquakes Large leaks and releases of concentrated CO2 are toxic to plants and animals.42 a The 2006 Mammoth Mountain, CA release left dead stands of ... can acidify saline aquifers (akin to ocean acidification) and leach heavy metals, such as arsenic and lead, into ground water.42 Acidification of ground water increases fluidrock interactions that...

Ngày tải lên: 23/03/2014, 00:20

26 762 0
bài giảng chapter 9 the cost of capital

bài giảng chapter 9 the cost of capital

... 43 Divisional Risk and the Cost of Capital Rate of Return (%) Acceptance Region WACC WACCH H Rejection Region A WACCA B WACCL L RiskL RiskA RiskH Risk - 44 What are the three types of project risk? ... project s ROA and S&P index ROA Accounting betas are correlated (0.5 – 0.6) with market betas But normally can’t get data on new projects’ ROAs before the capital budgeting decision has been made 9 ... when calculating the cost of capital 9-4 Should we focus on before-tax or after-tax capital costs? Tax effects associated with financing can be incorporated either in capital budgeting cash flows...

Ngày tải lên: 30/10/2014, 08:23

54 698 0
w