ca2 imaging using conventional microscopy

... culture (68%) and microscopy (51%) However, its specificity was only 86% when compared to sputum microscopy (100%) and culture (97%) (Table 3) Comparison of PCR to conventional methods using McNemars ... every patient of tuberculosis who can be detected using microscopy, nine have to be screened using indirect methods due to the low sensitivity of microscopy1 7 This is the primary impetus for a world ... analysis 71 tuberculosis) were examined by smear microscopy, culture on LJ slants, and PCR using primers specific for MPB64 Results for sputum smear microscopy and PCR required less than 48 hours...

Ngày tải lên: 06/03/2014, 04:20

... NanoCenter entitled Imaging in Electron Microscopy in 2009 and 2010 and “New Frontiers in Imaging and Sensing” in 2011 At these workshops world-class practitioners of electron microscopy, engineers, ... the combination of state-of-the-art imaging using aberrationcorrected electron microscopy with applied and computational mathematics will enable a “new age” of imaging in both the hard and soft ... (1999) Incoherent imaging using dynamically scattered coherent electrons Ultramicroscopy 78:111–124 33 Browning ND, Chisholm MF, Pennycook SJ (1993) Atomic resolution chemical analysis using a STEM...

Ngày tải lên: 30/05/2014, 00:33

... brain using magnetic resonance imaging Med Imaging IEEE Trans 13(3), 470–481 (1994) doi:10.1109/42.310878 H Maitre, F Schmitt, JP Crettez, Y Wu, JY Hardeberg, in IS&T and SID’s 4th Color Imaging ... to the system 3D imaging in itself is an interesting area of study, and could be a large part of the study This paper, therefore, focuses mainly on multispectral imaging, and 3D imaging has not ... Microscopic and Mesoscopic Spectral Bio -Imaging 200–206 (1996) RS Berns, in CIM’98: Colour Imaging in Multimedia Challenges for Color Science in Multimedia Imaging Derby, UK, pp 123–133 (1998) RS...

Ngày tải lên: 21/06/2014, 00:20

... that the above discussion is based on ISAR imaging In ISAR imaging for a moving target, the target size is much smaller than the terrain scale of SAR imaging Thus, we can sample only one point ... suggestions 10 −5 Range (m) Figure 10: Imaging result using the proposed clutter cancellation method, where the clutter scatterers are randomly moving in the imaging process within (−1 m, m) −10 ... Cross-range (m) −5 10 −5 Range (m) Figure 11: Imaging result using the proposed clutter cancellation method, where the clutter scatterers are randomly moving in the imaging process within (−5 m, m) the...

Ngày tải lên: 22/06/2014, 23:20

... imaging technique The element migration problems that had blighted the early biomedical applications of the ion microanalyzer are largely avoided by an approach of imaging labeled molecules using ... spectrometer transmission can approach 100% Molecular ion imaging Several groups have pursued the idea of obtaining molecular image information using sputtered molecular ions themselves to form images ... prototype instrument became the core of the National Resource for Imaging Mass Spectrometry at Harvard As with the direct molecular imaging study of Ostrowski et al [9], the work now emerging from...

Ngày tải lên: 06/08/2014, 18:21

... with a size of 1130 bp using the S uberis skc gene specific primers SKC-I and SKC-II; skc gene negative S uberis and S parauberis are shown in lane and M = see Fig amplicons using S uberis 16S-23S ... parauberis as mastitis causing pathogen seems to be rare References Abdulmawjood, A., Soedarmanto, I and Lämmler, C Identification of streptococci of serological group C using fluorescein and peroxidase ... DNA of the isolates was performed as described [28] The gene encoding the 16S rRNA was amplified using the oligonucleotide primer ARI with the sequence 5' GAGAGTTTGATCCTGGCTCAGGA 3' [8] and the...

Ngày tải lên: 07/08/2014, 17:22

... animal studies The NIRF imaging technology has recently been extended to arthritic studies In vivo NIRF imaging of arthritis in experimental animals was demonstrated using a protease-sensitive ... mice serum R311 In vivo NIRF reflectance imaging and lesion assessment All animals were imaged in a prone position using a homebuilt NIRF reflectance imaging system, which has been described ... activated macrophages in adjuvant-induced arthritis mice models using gamma scintigraphy as the imaging modality [7] In contrast, optical imaging is a noninvasive method and does not depend on radiolabeled...

Ngày tải lên: 09/08/2014, 06:22

... sensitivity of the preoperative detection of ELCs Coronal imaging alone was not significantly better than axial imaging alone The coronal imaging helped with decisions on the extent of the resection ... recurrences The HRCT is clinically useful for the diagnosis of pneumothorax However, the conventional HRCT does not provide imaging of intervals less than10 mm Therefore, the images cover only approximately ... the diagnosis of pneumothorax However, the MDCT is capable of imaging at full resolution and improved on the limitations of the HRCT Imaging of all lung fields could be performed quickly and the...

Ngày tải lên: 10/08/2014, 09:21

... (selective electrode Page of (page number not for citation purposes) [SID]apparent = [Na+] + [K+] + [Ca2+ ] + [Mg2+] - [Cl-] The strong ion gap ([SIG]) is composed of strong anions other than [Cl-] ... difference between the sums of all the strong cations and all the strong anions), and the [Atot-] Using this approach, Fencl and colleagues have shown that the traditional analysis frequently failed ... [HCO3-], and [BE] levels because of a concomitant presence of hypochloremic alkalosis Both the conventional and Stewart approaches allow the identification of this mixed metabolic disorder The...

Ngày tải lên: 13/08/2014, 11:22

... on SNR improvement methods in STA imaging 9.5 Proposed STA coded imaging using Hadamard and FM space-time encoding 9.6 STA imaging with double frame rate using orthogonal FM signals ... ratio improvement 6.3 Imaging with linear FM signals- Simulation results using Field II 6.4 Imaging with non-linear FM signals 6.5 Imaging with complementary codes ... transmission 119 9.5 Conventional linear array imaging (left) and linear array imaging with double frame rate using two parallel FM-coded beams The dynamic range...

Ngày tải lên: 24/08/2014, 17:52

... Portal Imaging Br J Radiol 2001, 74:789-804 Herman MG: Clinical use of portal imaging Semin Radiat Oncol 2005, 15:157-167 Hurkmans CW, Remeijer P, Lebesque JV, Mijnheer BJ: Set up verification using ... served as reference images for comparison with the portal images Portal imaging and evaluation Portal images were acquired using BEAMVIEW® (version 2.2, Siemens Medical Solutions, Concord, CA, ... margins were calculated using the International Commission on Radiation Units and Measurements (ICRU) Report 62 [2], Stroom's [6,7], and van Herk's [8,9] formulae (Table 1) Using the ICRU recommendation,...

Ngày tải lên: 09/08/2014, 10:21

... D4, D2, serotonin type 2, norepinephrine, acetylcholine, and histamine [20-22] Functional brain imaging methods have been applied for studying schizophrenia These methods include positron emission ... [10], SPECT for studying CBF and neuroreceptors, and more recently, functional magnetic resonance imaging (fMRI) for measuring changes attributable to cerebral blood flow In this paper, after summarizing ... design and in reconstruction algorithms have substantially improved the quality of SPECT images using the Anger type gamma camera SPECT images can be merged with MRI and CT, creating a single...

Ngày tải lên: 02/11/2012, 11:12

... cloning process manually after using command to set up the server, and then you’ll learn how to start cloning on the clients C HA P TER USING UBUNTU SERVER FOR SYSTEM IMAGING Setting Up the Server ... easy, because the program will detect almost all settings automatically C HA P TER USING UBUNTU SERVER FOR SYSTEM IMAGING The first couple of questions ask you about the DNS configuration you want ... Once what you expected, and if it is, proceed with the configuration C HA P TER USING UBUNTU SERVER FOR SYSTEM IMAGING Listing 2-3 The DRBL Setup Program Shows What It Is Going to Configure Next...

Ngày tải lên: 19/10/2013, 02:20

... glyceraldehyde-3-phosphate dehydrogenase in a Ca2+ ⁄ calmodulin-dependent manner J Biol Chem 279, 35176–35184 14 Wallrabe H & Periasamy A (2005) Imaging protein molecules using FRET and FLIM microscopy Curr Opin Biotechnol ... of fluorescence resonance energy transfer (FRET) between two fluorescent proteins using fluorescence lifetime imaging microscopy (FLIM) is a technique for the observation of protein–protein interactions ... min, giving rise to peak values of FRET imaging of interaction between GAPDH and PGK approximately 2000 photon counts Fluorescence lifetime data were analyzed using global analysis with multiexponential...

Ngày tải lên: 16/02/2014, 09:20

... Rinia HA & de Kruijff B (2001) Imaging domains in model membranes with atomic force microscopy FEBS Lett 504, 194199 17 Yuan C & Johnston LJ (2001) Atomic force microscopy studies of ganglioside ... bilayer, as conrmed by immunouorescence imaging (Fig 3A) Figure 3A1 shows a planar lipid bilayer reconstituted with V-PPases and analyzed by immunouorescence using a primary antibody against His ... from the mica surface (C) Histogram of V-PPase height determined using the AFM image in (A) (D) Histogram of V-PPase width determined using the AFM image in (A) 4384 FEBS Journal 276 (2009) 43814394...

Ngày tải lên: 16/03/2014, 02:20

... fluorescence microscopy Photochem Photobiol Sci 4, 13–22 Wallrabe H & Periasamy A (2005) Imaging protein molecules using FRET and FLIM microscopy Curr Opin Biotechnol 16, 19–27 FRET imaging of ... occurrence of FRET in addition to the decreased fluorescence lifetimes of donor proteins using time-domain FLIM Using the FRET–FLIM technique, we observed strong intermolecular FRET signals between ... presence of the acceptor (Table 1), indicating trans- FRET imaging of the VBC complex EloB-Ceru + Cit-EloC 0.1 0.01 14 10 12 14 Time/ns 5569 FRET imaging of the VBC complex K Kinoshita et al Table Fluorescence...

Ngày tải lên: 16/03/2014, 05:20

... integrate with MAPLE for in situ sintering This paper investigates the implementation of MAPLEDW using conventional microelectronic inks with an IR laser and X-Y scanner for high-speed writing Previous ... substrate using a glass rod and steel shims because the unadulterated QS300 is too viscous for the use of a wire or spin coater The thickness of the ink layer can be controlled by using different ... controlled by using different sets of shims Time histories of the MAPLE-DW event were captured using high-speed microscopy for 0.5-, 1.0-, and 2.0-mil ink layer thicknesses, with beam waists of 15 and...

Ngày tải lên: 06/05/2014, 08:53

... performed on the largest subset of data to determine whether within assay variability would change when using the improved counting method We evaluated all of the tests performed on the lyophilized reference ... facilitates conservation of primary and secondary antibody stocks, which is an important factor when using http://www.virologyj.com/content/2/1/84 Figure complement separated by serum titers with Boxplots ... inoculated at 100 µl/well Plates were incubated at 37°C, 5% CO2 for days to allow for plaque formation Conventional staining and plaque determination for RSV neutralization Cells infected on transparent...

Ngày tải lên: 19/06/2014, 08:20

... MacConeil using phase contrasted microscopy [1] It was then argued as an artifact generated by phase contrasted microscopy [2] Transmission electron microscopy [3,4] and scanning electron microscopy ... Electron microscopy (EM) is the only imaging technique that has sufficient image resolution for studying the more detailed collagen structure in AC However, this technique requires special imaging ... computer program is used to reconstruct them as a 3D image Confocal microscopy has a higher image resolution than conventional light microscopy It also allows study of the internal microstructure...

Ngày tải lên: 20/06/2014, 01:20

... performed on the largest subset of data to determine whether within assay variability would change when using the improved counting method We evaluated all of the tests performed on the lyophilized reference ... facilitates conservation of primary and secondary antibody stocks, which is an important factor when using http://www.virologyj.com/content/2/1/84 Figure complement separated by serum titers with Boxplots ... inoculated at 100 µl/well Plates were incubated at 37°C, 5% CO2 for days to allow for plaque formation Conventional staining and plaque determination for RSV neutralization Cells infected on transparent...

Ngày tải lên: 20/06/2014, 04:20