biological phenomenon and experimental model of human epilepsies

... chronic and seasonal nutritional deprivation existed, Page of 11 partly because of the low dietary intake and the hungry/ high infection and harvest/low infection seasonal cycles of weight lost and ... article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden Journal of Biomedical Science 2011 18:41 Submit ... in detail[3] Briefly: μl of DNA from standards and samples were added to 18 μl of master mix containing 0.3 μM of sjTREC specific forward: GCCACATCCCTTTCAACCATGCTGAC and reverse: TTGCTCCGTGGTCTGTGCTGGCATC...

Ngày tải lên: 10/08/2014, 05:21

... neur~phys.IOIogy of aesthetic experience Third, we will review some work on the biOlogIcal bases of the aesthetic experience that speak to some of the predlcllons and hypotheses derived from the model of aesthetic ... status of the model of aesthetic experience based on the available biological data, and will outline specific hypotheses that can be used to test the so-called joints in the system A Model of Aesthetic ... visual and emotional levels towards early visual processing A comparison of the models proposed hy Leder and colleagues (2004) and Chattetjee (2003) reveals similarities and differences Both models...

Ngày tải lên: 19/02/2014, 17:20

... of rats exposed to an animal model of depression This activation occurs with increased levels of the pro-inflammatory cytokine IL-1b and of one of the main enzymatic sources of inflammatory and ... and interpretation of data and revising the manuscript critically; LB and EB contributed to acquisition, analysis and interpretation of CMS model and behavioural data; JAM and JRC revised the ... production of proinflammatory cytokines, expression of COX-2 and, as a co-factor, activity of indoleamine 2,3-dioxygenase (IDO), which reduces levels of 5-HT, a hallmark of depression On the other hand,...

Ngày tải lên: 19/06/2014, 22:20

... CD47/ IAP is expressed by human articular chondrocytes and to establish whether it and potential ligands such as TSP and SIRPα have roles in integrin-dependent responses of human articular chondrocytes ... presence of potential ligands and to investigate possible interactions Protein extracts from primary cultures of human articular chondrocytes were first immunoblotted for TSP-1 and SIRPα, and expression ... Expression of thrombospondin-1 (TSP-1) and signal-regulatory associaalpha (SIRPα) by human articular chondrocytes and molecular associations of CD47/IAP (a) Protein extracts from primary cultures of human...

Ngày tải lên: 09/08/2014, 10:22

... levels of risk to SLE There is an approximately twofold increase in the level of risk between carriers of the highest and lowest risk haplotypes Second, candidate genes from a region of LD can ... present in about 1% of cases and 2% of controls (P = 2.1 × 10-16) and rs35337543 in 1% of cases versus 1.5% of controls (P = 1.4  × 10-4) Both mutations are predicted to be loss-offunction mutations, ... to GWASs and next-generation sequencing, registries of blood draws from healthy, consenting human volunteers enable functional studies of genetic variants in a wide range of primary human immune...

Ngày tải lên: 09/08/2014, 20:21

... average of ≥ measurements ± standard error of the mean (SEM) Significance of P ≤ 0.05 is indicated with an asterisk temperature-controlled and light-controlled conditions in the University of Maryland, ... Author details Department of Pharmacology and Experimental Therapeutics, University of Maryland School of Medicine, 655 West Baltimore St BRB-400-2 Baltimore, Maryland 21201 USA 2Fuzbien Technology ... factor-I and serum IGF-binding protein can be associated with the progression of breast cancer, and predict the risk of recurrence and the probability of survival in African-American and Hispanic...

Ngày tải lên: 11/08/2014, 00:23

... become available and is incorporated into the software of specific intensive care ventilators [13] Therefore, we compared FRC, Crs and PaO2 evolution in an experimental model of ARDS during a ... ramp procedure of PEEP changes to investigate the potential interest of combining FRC and Crs measurements in such a pathologic state Materials and methods All experimental procedures and protocols ... from 20 and 15 cm H2O suggests that alveolar overdistension was present at a PEEP of 20 cm H2O In this study, the optimal level of PaO2 was obtained at a PEEP of 20 and 15 cm H2O Because one of the...

Ngày tải lên: 13/08/2014, 11:22

... Schulz A, Ghofrani HA, Breitenbach CS, Weissmann N, Hildebrand M, Kurz J, Grimminger F, Seeger W: Comparison of pharmacokinetics and vasodilatory effect of nebulized and infused iloprost in experimental ... in mean PA pressure and RV-Mw, when a level of significance of 0.05 and a power of 80% were to be achieved Results were statistically analyzed using a commercially available software package (Statistica© ... Materials and methods This investigation conforms to the Guide for the Care and Use of Laboratory Animals, published by the US National Institutes of Health (Publication No 85-23, revised 1996) [17] and...

Ngày tải lên: 13/08/2014, 11:22

... a CLP experimental model of sepsis was used [21] The CLP is certainly a good model of peritonitis, and we not know if these results can be directly shifted to other experimental models of sepsis ... preparation, performance of experimental work, analysis of the mechanical and morphometrical data CMD: Animal preparation, performance of experimental work, analysis of the mechanical and morphometrical ... supervision and overview of entire project PRMR: Experimental design, supervision of experimental work, statistical analysis, writing of the manuscript, supervision and overview of entire project...

Ngày tải lên: 13/08/2014, 16:20

... components of a subject-specific model of human skull and brain (Model 1) segmented from CT and MRI data by Mimics The meshed model on the right shows the mid-sagittal view of the skull and CSF ... 103] (A) The skull model; (B) the brain model with 11 pairs of bridging veins; (C) sagittal cross section of the head and neck model; (D) anatomical structures modeled in KTH model ... nodes of the base of the neck of Model 119  Figure 38: Mid-sagittal view of the displacement magnitude (in mm) contour plots of the head-neck model, showing various mode shapes and...

Ngày tải lên: 10/09/2015, 09:04

... activity of the human enzyme was not regained upon removal of EDTA and addition of metal-ions Figure shows the hydrophobicity profiles of human and P fluorescens ACMSD, performed according to Kyte and ... backbones of the human enzyme model and the crystallographic templates are ˚ all below A The residues that directly coordinate to A B C Fig 10 Homology modeling of human ACMSD I Prediction of the human ... [21] From the sequence alignment of human and bacterial ACMSD and the comparison of their three-dimensional structures, the presence of the metallocofactor in the human enzyme can be reliably predicted...

Ngày tải lên: 19/02/2014, 02:20

... predictability of the model on empirical reading data with the probability decrease and the presence or absence of probability reranking Adopting the standard experimental design used in human sentence ... point and at the disambiguation region compared to the control sen53 used and the interpretation of the model for human sentence processing Corley and Crocker clearly state that their model is ... predictions can be and cannot be made by this model This allows systematic testability and refutability of the model unlike some other probabilistic frameworks Also, the model training and testing is...

Ngày tải lên: 20/02/2014, 11:21

... [20]: koff ẳ koff2ị ẵibuprofen=K2 ẵibuprofenị ỵ koff3ị ẵibuprofen=K3 ẵibuprofenịị ỵ kỵ off 7ị where koff(2) and koff(3) indicate values of koff occurring at K2 < [ibuprofen] < K3, and at ... functional and structural properties of domains I and II [i.e of the 1382 region of (t)HSA] l The values of the Hill coefcients (n1, n2, and n3) for ibuprofen binding to tHSAheme and HSAheme ... low-afnity sites of tHSAheme-Fe(III) and HSAheme-Fe(III) [represented by a and (1 a), respectively, in Eqn (1)] are 0.18 and 0.82, and 0.14 and 0.86, respectively (Table 1) Effect of ibuprofen on peroxynitrite...

Ngày tải lên: 06/03/2014, 01:20

... banks and the dimensions of access C Savings banks and the provision of access D Savings banks and the double bottom-line 11 Summary of Key Findings 17 Savings Banks and the Dimensions of Access ... Future of Microfinance [CGAP 2004] The paper studied a set of institutions that have two bottom-lines – the traditionally known one of the profit and loss account and the equally longstanding ... inclusion of credit products (and very often insurance products as well) 36 SAVINGS BANKS AND THE SUPPLY OF ACCESS A Measuring the supply of access As part of its contribution to the UN Year of Microcredit,...

Ngày tải lên: 06/03/2014, 10:20

... the development of the advanced functions of human nervous system in light of the Gene Ontology (GO) profile of human orthologs Results Characters and distribution of LIRs in human autosomes We ... rhesus monkey and mouse orthologs Our data suggest that most of the LIRs shared by human and chimpanzee orthologs were developed and maintained by the common ancestor of humans and chimpanzees ... human genome, and provide a fine map of the distribution of human LIRs Due to a strong capability for forming a stem-loop, the LIRs are recombinogenic and account for only approximately 0.4% of...

Ngày tải lên: 07/03/2014, 00:20

... properties of SEPT2 for GTPcS and GDP, respectively, may also indicate different conformations in recognizing triphosphate and diphosphate guanine nucleotides The similarity of the Kd, koff and kcat of ... Huang et al GTPase properties of human SEPT2 Table Summary of the GTPcS and GDP dissociation constants and stoichiometrical binding site (n) for wild-type SEPT2 and S218A mutant The data for ... that of GDP dissociation Surprisingly, the data best fit to either single or bi-exponential decay models depending on the Mg2+ concentration The summary of the koff rates of SEPT2 for GTPcS and...

Ngày tải lên: 07/03/2014, 12:20

... chromatography and chromatofocusing, as described previously [21] Results Expression and secretion of truncated variants of GCPII To analyze the contribution of individual domains of human GCPII ... GCPII hydrolytic activity and substrate binding Recently, a 3D model of the extracellular region of rat GCPII has been published [20] In addition to the model of the ligand-free protein, the authors ... NaCl and 20 lL of the GCPII sample, were preincubated for 15 at 37 °C in a final volume of 225 lL A 25 lL mixture of 950 nM ÔcoldÕ NAAG (Sigma) and 50 nM H-labelled NAAG (51.9 CiÆmmol)1; New England...

Ngày tải lên: 07/03/2014, 15:20

... Amino-acid sequence and tryptic peptides of human HCII The peptides indicated below were detected by MALDI-TOF- and/ or ESI-MS (see Figs and 2, respectively) in tryptic digests of human HCII isolated ... were isolated at random, exposed to 0.05 lM MTX, expanded, and checked for the presence of human HCII mRNA by RT-PCR Positive cell lines were picked and after several rounds of selection with ... Heparin cofactor II: N-glycans and sulfation (Eur J Biochem 269) 981 Fig MALDI-TOF-MS tryptic peptide fingerprints of natural (A) and recombinant (B) HCII Amino-acid sequence, calculated, and experimentally...

Ngày tải lên: 08/03/2014, 22:20

... single-domain protein composed mainly of a helices (Figs and 2) The core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands and 2, each consisting of two a helices (aA, aB and aC, aD, respectively) ... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Furthermore, F-actin binding and cross-linking assays were performed with both human...

Ngày tải lên: 16/03/2014, 06:20

... 400 nm with excitation and emission band pass of nm and nm, respectively ð3Þ DGUÀFH2 O ð4Þ where aF and aU are the intercepts and bF and bU are the slopes of the baselines of the equilibrium fluorescence ... speed of 200 nmÆmin)1 and a response time of s Each spectrum was the average of five scans The CD data were analysed using a JASCO software package Ó FEBS 2004 Mechanism of folding and unfolding of ... of Nile red Ó FEBS 2004 Mechanism of folding and unfolding of HSA (Eur J Biochem 271) 1795 Fig Equilibrium refolding of HSA in the presence of different concentrations of GdnHCl The recovery of...

Ngày tải lên: 16/03/2014, 16:20