binding of metal ions or complexes at organic polymers
Handbook of Polymer Synthesis Second Edition Episode 11 pptx
... incorporation of different kinds of metal complexes or metal chelates in linear or crosslinked organic or inorganic macromolecules The formation and stabilization of metal and semiconductor cluster ... necessary B Binding of Metal Ions or Complexes at Organic Polymers Different polymer analogous reactions are applied for the functionalization of polymers by ligands or metal ion /complexes/ chelates The ... dihydroxyquinoxalines or -quinolines [301–304] Coordination polymers of transition metal ions with different tetrathiolates such as tetrathiooxalate [305], tetrathiosquarate [306], tetrathiofulvalene tetrathiolate...
- 77
- 495
- 1
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx
... for gel-filtration chromatography was purchased from Bio-Rad Laboratories (Hercules, CA, USA) Biacore sensor chip CM5, was obtained from Biacore (Uppsala, Sweden) The restriction enzymes, EcoRI ... ratio of dissociation of the variant to that of the wild-type The amino acids mutated to alanine are designated by a single-letter code variants, 13 caused a significant impairment in binding of ... activities, it is assumed that the function of the 4-kDa peptide also relates to the regulation of the 43-kDa protein kinase activity In this work, we performed gel-filtration chromatography to study the...
- 10
- 420
- 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc
... obligatory for dimer stabilization but contribute to the overall stability of the dimers, particularly upon detergent solubilization It has been reported that inappropriate folding of proteins or ... functional roles including formation of a transmembrane pore, allowing for transport of cADPR into the cytosol [37] However, it is clear that stable homodimers are not obligate for enzyme activity as ... points of 7.7 and 7.2 and two minor points at 7.4 and 7.1 (Fig 1C) Analysis of p95 revealed isoelectric points of 7.7, 7.2 and 7.1 (Fig 1C) These points were located at similar positions to the corresponding...
- 10
- 448
- 0
báo cáo hóa học:" Unsaturated phosphatidylcholines lining on the surface of cartilage and its possible physiological roles" potx
... DPPC) chloroform solution at a concentration of 21.85 mg/ml was deposited on each side of a disc of white nylon filter paper with a pore diameter of 0.2 µm (Millipore Corporation, Bedford, MA, ... total percentage of all saturated fatty acids was about 39% and the majority of fatty acids were unsaturated fatty acids (61%) As two fatty acids are needed to form an intact SPC or USPC molecule, ... requires two saturated fatty acids, ie palmitic acid PLPC, POPC and SLPC require one saturated fatty acid, either palmitic or stearic acid, and one unsaturated fatty acid, either linoleic or oleic...
- 6
- 432
- 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
... discovery of a new quantum state of matter, topological insulator, has generated a lot of interest due to its great scientific and technological importance [1–5] In a topological insulator, spin–orbit ... investigate quantum tunneling through a single electric and /or magnetic barrier on the surface of a three-dimensional topological insulator We found that (1) the propagating behavior of electrons ... potential barriers which can be created by depositing a ferromagnetic metallic strip on the surface of a 3D topological insulator We find that the in-plane spin orientation of the transmitted and the...
- 18
- 404
- 0
Báo cáo lâm nghiệp: "Interactions of ozone and pathogens on the surface structure of Norway spruce needle" potx
... Tubular wax covering the stomata was more often flat and solid under ozone exposure with concentrations higher than 200 !g The change was observable at the edges of the stomata (P= 0.0346) The apparently ... could be observed in the material that was fumigated with higher ozone concentrations The surface structure of infected control samples was also more eroded than that of uninfected control needles ... nadein von Picea abies (L.) Karst Forstwiss CentratbG 105, 234-238 Sauter J.J & Voss J.U (1986) SEM observations on the struoturat degradation of epicuticular waxes of Picea abies (L.) Karst and its...
- 4
- 263
- 0
Báo cáo y học: "Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture" doc
... denaturation step at 92°C for minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds and extension at 72°C for minute Direct sequencing of bacterial ... cycles of denaturation at 94°C for minute, annealing at 58°C for minute and extension at 72°C for 1.5 minutes, and finally an extension step at 72°C for 10 minutes PCR quality control When performing ... inhibition of amplification by self-annealing of the most abundant templates in the late stages of amplification [50] or as a result of differences in the amplification efficiency of templates [51]...
- 11
- 491
- 0
Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot
... culture) for h at 37°C After washing steps, 100 μl of HRP-conjugated goat-anti mouse IgG (Invitrogen, USA) was added and the plates were allowed to incubate for h at 37°C Then, 100 μl of TMB substrate ... 100 μl of M H2SO4 The absorbance was measured at wavelength 450 nm The cutoff is defined as the mean value of absorption of serum samples from mice immunized with normal saline or that of fresh ... pre-incubated with equal volume of serially diluted MAb or sCD4 at 37°C for h After that, 75 μl of PHA-stimulated PBMCs (1.34 × 106 cells/ml) was added and allowed to incubate at 37°C, 5% CO2 for 18...
- 8
- 445
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... µl of cells were incubated with µl of neat antibody for 30 minutes at 4˚C in the dark, washed and resuspended in 0.5 ml of PBS For intracellular measurement of HLA-DR the PBMC were fixed for ... 100µl of avidin peroxidase conjugate (1/1000) was added to each well and incubated for 30 minutes at room temperature Plates were washed thoroughly, then 50µl per well of chromogen/substrate (0.3mg/ml ... study indicates that GM-CSF is also able to regulate HLA-DR at the level of transcription To investigate whether a post-translational modification was a mechanism involved in the regulation of HLA-DR,...
- 11
- 618
- 0
Effect of urban emissions on the horizontal distribution of metal concentration in sediments in the vicinity of Asian large cities
... contamination This study shows that the sediments of streams that receive untreated wastewater contained higher concentrations of lead and zinc The data on the metal concentration of wastewater ... Juan River (Station SJ), which collects untreated wastewater and urban storm water runoff, contained high concentrations of lead and zinc Table summarizes the results of all the target metals in ... horizontal distribution of copper, nickel, lead and zinc concentrations in the sediments The distribution of copper and that of nickel made it difficult to simply correlate their concentrations...
- 11
- 440
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... dramatic difference in size, and in agreement with previous comparative work of binding inorganic and protein partners to cytochromes c3 [6] Table shows that as for the case of phosphate binding, ... (methyl nomenclature according to IUPAC-IUB recommendations [27] and Roman numerals designate the order of attachment of the haem to the polypeptide chain), which confirms the extensive work of molecular ... Experimental data reported in the literature argue in favour of a specific binding of phosphate to cytochrome c3 [23] instead of a simple electrostatic effect of increased ionic strength at least up...
- 10
- 640
- 0
Tài liệu Báo cáo khoa học: Coordination chemistry of iron(III)±porphyrin±antibody complexes In¯uence on the peroxidase activity of the axial coordination of an imidazole on the iron atom ppt
... 13G10-a,b-1,2-Fe(DoCPP) a plateau value of 0.72 lM ABTS oxidized per for a concentration of imidazole of 50 mM (Fig 6) For concentrations of imidazole higher than 100 mM the rate of oxidation of ABTS started ... initial rates of oxidation were determined from the slope at the origin of the curve representing the variations of the absorbance at 414 nm as a function of time, using an e value of 28 000 ... for concentrations of imidazole higher than 50 mM, as shown by the curves representing the variations of the rates of oxidation of ABTS by H2O2 observed, respectively, for those two catalysts (Fig...
- 11
- 470
- 0
Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx
... activator with affinity for fibrin, the new plasminogen activator had comparable affinity for integrin to that of Fab 9, with no loss of fibrin -binding function Although peptide fragments have often ... investigated deviations in the amino acid sequences of the CDRs of 1330 human light chains to identify the candidate residues important in the light chain conformation Peptide grafting into locations ... structure of TOP that was identified by molecular dynamics simulation as a suitable location without denaturation (Fig 2B) CDR-grafted TOP had affinity for CD4 receptor, and was not denatured even at...
- 9
- 505
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... subdomain conformations to the catalytic mechanism are discussed below The role of the third metal in catalysis In MtSTP [9], Ser160 takes part in binding M3 metal by forming two of the coordinating ... for 20 cycles with REFMAC5 Coordinations for the metal ions and for Asn160 are indicated by dashed lines (B) Superimposition of monomers A and C of SaSTP, and MtSTP monomer A [9] Monomer C of ... binding of the third metal ion suggesting, like Pullen et al [9], that rearrangement of the flap domain in HsSTP might lead to binding of a third metal ion The implications of the M3 binding and...
- 10
- 542
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... volume of air-saturated NaCl ⁄ Pi (pH 7.5), and incubated at room temperature for h to ensure oxidation of the outer membrane cytochromes Absorption spectra of mL fractions were recorded at 554 ... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... reduction [6,8] Although the importance of bacterial dissimilatory metal reduction in controlling the fate and transport of metals and their potential for remediation purposes are well recognized,...
- 11
- 731
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... Accuracy of models As expected, the accuracy of the structure Glu1.1 at atomic resolution is higher than that of Glu-A or Glu The overall coordinate error for Glu1.1 and Glu-A estimated from ... R15A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R15A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H447A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T462A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T462A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);...
- 11
- 548
- 0
Báo cáo Y học: Membrane embedded location of Na+ or H+ binding sites on the rotor ring of F1F0 ATP synthases ppt
... excitation wavelength of 342 nm The excitation and emission monochromator slit widths were set at nm For titration of uorescence yield with different quencher concentrations, samples were incubated ... glutamate or aspartate in the c ring of F1F0 ATP synthases Labelling of these sites with the uorescent derivative N-PCD provides unique options to monitor by uorescence Parallax method of depth ... cGlu65 of the ATP synthase of I tartaricus or cAsp61 of the ATP synthase of E coli and is therefore suitable for uorescence investigations Reconstitution of the E coli ATP synthase into POPC-liposomes...
- 9
- 439
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... A] and incubated at 37 °C for h Cell lysates were then treated with protease K (0.2 mgÆmL)1) at 54 °C for 30 The genomic DNA was isolated by two with two rounds of phenol–chloroform extraction ... Furthermore, the ATP -binding domain of HSP70 is critical for sequestering AIF in the cytosol [29] In the present study, we demonstrated that the ATP -binding domain of HSP70 was indispensable for inhibition ... time, this cDNA was used as the template for PCR amplification of two HSP70 truncated mutants with deletion of the ATP -binding domain (HSP70DATP-BD) or the peptide -binding domain (HSP70DPBD) using...
- 10
- 726
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu