back to c why c is not c
Playing With the Boys - Why Separate is Not Equal in Sports
Ngày tải lên :
10/06/2015, 17:16
... Protection Clause, crafted by Congress to prohibit discrimination based on race, to bear on cases involving discrimination based on sex This case and the Supreme Court decision had far-reaching implications ... in American society compared to men Intersectionality Taken together, human beings constitute an intersection of many ascriptive characteristics acquired at birth, such as their race, class, religious ... ascriptive characteristics, such as race, nationality, and disability, necessarily intersect with sex difference discrimination A full analysis of the intersectionality dimension of sex discrimination...
- 376
- 317
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
Ngày tải lên :
16/02/2014, 14:20
... the catalysis of disulfide bond formation and isomerization by PDI PDI is a catalyst of thiol–disulfide exchange reactions, including oxidation, reduction and isomerization [1] Bacitracin is not ... millimolar concentrations to inhibit PDI in vivo, the risk of nonspeci c effects on other systems increases even more Furthermore, the mechanism of action of bacitracin is not very effective in ... opposing effects on the fluorescence of the system in the presence of bacitracin First, there is a net increase in fluorescence due to the bacitracin However, with excitation at 280 nm and emission at...
- 9
- 620
- 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
Ngày tải lên :
06/03/2014, 00:20
... Biogenesis of cytochrome c H Inoue et al attachment to class I cytochromes c is catalyzed by the cellular machinery, resulting in cytochrome c biogenesis [5] For example, in some Gram-negative bacteria, ... of cytochromes c In From Cyclotrons to Cytochromes (Kaplan NO & Robinson A eds), pp 263–280 Academic Press, New York Ascenzi P, Santucci R, Coletta M & Polticelli F (2010) Cytochromes: reactivity ... in E coli strains with reference to PH c5 52, which has been characterized as a System I-dependent cytochrome c Biogenesis of cytochrome c Heterologous synthesis of PHCP by E coli The E coli...
- 8
- 606
- 0
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot
Ngày tải lên :
15/03/2014, 10:20
... the NaCl ⁄ Tris mouse brain extracts was revealed by the ectodomain-directed antibody 2 2C1 1 but not by the C- terminal speci c antibody C8 indicates that this protein lacks an intact C- terminus ... loss of BACE1 cleavage In direct NaCl ⁄ Tris-T extracts, we could not detect ICDs of either APP or APLP2, but we did detect a band consistent with APLP1 ICD, possibly because APLP1 ICDs are more ... in ICD levels is unclear One potential explanation is that, owing to spatial differences, a-secretase-derived CTFs are more prone to c- secretase cleavage than b-secretase-derived CTFs The fact...
- 16
- 549
- 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
Ngày tải lên :
22/03/2014, 20:20
... t ∈ In }, is an arc-wise connected subset of On To prove (a), it suffices then to show that any λ in On is connected to some point in In via a continuous curve γλ , which is entirely contained ... desired u(A0 ) = C 1B r 719 A NEW APPLICATION OF RANDOM MATRICES For any element c of a C ∗ -algebra C, we denote by sp (c) the spectrum of c, i.e., sp (c) = {λ ∈ C | c − λ1 C is not invertible} ... The Gaussian Poincar´ inequality is a folklore result which goes back to e the 30’s (cf Beckner [Be]) It was rediscovered by Chernoff [Cf] in 1981 in the case N = and by Chen [Cn] in 1982 for general...
- 66
- 378
- 0
Why American History is Not What They Say - An Introduction to Revisionism docx
Ngày tải lên :
28/03/2014, 21:20
... WHY AMERICAN HISTORY IS NOT WHAT THEY SAY : AN INTRODUCTION TO REVISIONISM also by jeff riggenbach In Praise of Decadence WHY AMERICAN HISTORY IS NOT WHAT THEY SAY : AN INTRODUCTION TO REVISIONISM ... facts, no two historical accounts would agree, and the discipline of history would be plunged into chaos 17 Barnes, op.cit., p 267 24 THE ART OF HISTORY II History and Fiction But we should calm ... represent a selection made by successive historians for the purpose of historical reconstruction and explanation But “[i]f historical facts are selected, it is important to identify the criteria employed...
- 214
- 1.1K
- 0
![Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt](https://media.store123doc.com/images/document/14/rc/kt/medium_AqRuqpZDo1.jpg)
Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt
Ngày tải lên :
30/03/2014, 08:20
... sense primer CTCCCCCCTTACACAGGATG TGGATATTACCACATCTGCGTCAGC and the corresponding antisense primer In additional experiments, we used the pGL3 vector containing F-luc driven by the c- Fos promoter ... amplified by PCR from human HeLa cell genomic DNA, using TCGCTAGCGTCTGCTTCCACGCTTTGCACT and ACAGATCTGCTGTGGAGCAGAGCTGGGTA primers bearing NheI and BglII restriction sites, respectively c- Fos promoter ... transcription factors; SRF, serum response factor; CArG, CC-A + T-rich-GG box; AP-1, activator protein-1; FAP, fos-AP-1 binding sequence; RCE, retinoblastoma (Rb) control element; CREB, CRE-binding...
- 11
- 449
- 0
Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf
Ngày tải lên :
31/03/2014, 08:20
... in the CFTR protein (cystic fibrosis transmembrane conductance regulator) causing cystic fibrosis forms a functional chloride conductance in Xenopus laevis oocytes but not in mammalian cells The ... the whole cell configuration of the patch clamp (Fig 4B .C) Concentrations of tolbutamide (100 lM) known to act selectively by binding to SUR1 and not to have significant pore blocking effects were ... [11,13,14] The cytoplasmic C- terminus of SUR1 containing NBD2 is mutated in persistent hyperinsulinaemic hypoglycaemia of infancy The disease is autosomal recessive and is characterized by profound...
- 11
- 467
- 0
schechter - the crime of our time; why wall street is not too big to jail (2010)
Ngày tải lên :
03/11/2014, 16:57
... force majeure clause of his contract Trump claimed his financial problems were not his fauly because he did not create the crisis, as if his financial reverses ever are his responsibility His ... for financial innovation was specifically designed to conceal risk, obfuscate investors and reduce transparency The process was entirely deliberate Efficiency and transparency are not consistent ... and serious crime A harsh judgment, but it’s not easy to dismiss the case that he constructs.” – Noam Chomsky “Did the current economic crisis result simply from market forces, misjudgment and...
- 313
- 409
- 0
English back to basics classroom and homework activities book c
Ngày tải lên :
27/08/2016, 18:32
... English - Back To Basics - y,2!P English - Back To Basics - y,3/P English - Back To Basics - Y,4!P English - Back To Basics - y, SIP English - Back To Basics - Yr6/P English - Back To Basics - ... in th is serie s: English -Back To Basics (Yr liP Z) English - Back To Basics (Yr VP 3) English - Blick To Basics (Yr 3/P 4) English - Blick To Bllsics (Yr 4/P 5) English - Blick To Bllsics (Yr ... scream ( bl screen (,I scratch (dl scrub (,I screw (I) scribble I ( I scruffy, scratch (bl scribbled, scrap • ,• K J Eng/ish - Back To Basics 10 spr scr , Write spr to finish the words in each...
- 105
- 146
- 0
Kiểm toán khoản mục CPSX trong kiểm toán BCTC to C.ty cổ phần kiểm toán & Định giá Việt Nam thực hiện
Ngày tải lên :
14/11/2012, 10:36
... cho Kế to n NVL C ng ty theo dõi chặt chẽ, chi tiết thứ, nhóm loại * Hạn chế: M c dù tổ ch c công t c Kế to n NVL C ng ty D c liệu TW1 đ c th c cách hiệu quả, song số tồn c n kh c ph c nh: - ... xuất Phòng tổ ch c Ghi chú: Quan hệ đạo Quan hệ cung c p Phòng bảo vệ Đ c điểm tổ ch c hạch to n Kế to n c ng ty D c liệu TW I 4.1 Hình th c Kế to n C ng ty sử dụng Hiện nay, C ng ty D c liệu TW1 ... liệu C ng ty D c liệu TW1 *Ưu điểm: C ng t c hạch to n Kế to n NVL nhìn chung đ c tổ ch c cách quy mô thống Kế to n NVL theo dõi, phản ánh c ch đầy đủ tình hình nhập - xuất - tồn vật liệu cung c p...
- 28
- 227
- 0
Đặc trưng văn hóa – dân tộc của tiếng Việt, những nghiên cứu khởi đầu
Ngày tải lên :
06/04/2013, 10:24
... xem sách, bên c nh c giỏ đựng đỏ Ông lão bảo c p vợ vợ chồng lấy chép sẵn sách, hồng giở để bu c chân vợ chồng với Vi C hỏi vợ ông lão cho biết người ăn mày chợ Hôm sau, Vi C định giết chết ... - C c thái độ, c chỉ, hành vi - Hiện tượng gọi “b c tranh dân t c giới” - phản ánh đ c điểm tri gi c th c khách quan thông qua đ c điểm tâm lí tư dân t c người thu c văn hóa - Nghệ thuật đ c ... ta thường dựa vào thu c tính chúng làm để hiểu to n vật, tượng, khái niệm Nhưng dân t c có c ch nhìn nhận, phản ánh kh c th c tế Do vậy, đối tượng, c c ch đặt tên kh c Chẳng hạn, đối tượng mà...
- 10
- 537
- 2
Đặc trưng văn hóa – dân tộc của tiếng Việt, những nghiên cứu khởi đầu
Ngày tải lên :
17/04/2013, 16:09
... xem sách, bên c nh c giỏ đựng đỏ Ông lão bảo c p vợ vợ chồng lấy chép sẵn sách, hồng giở để bu c chân vợ chồng với Vi C hỏi vợ ông lão cho biết người ăn mày chợ Hôm sau, Vi C định giết chết ... ta thường dựa vào thu c tính chúng làm để hiểu to n vật, tượng, khái niệm Nhưng dân t c có c ch nhìn nhận, phản ánh kh c th c tế Do vậy, đối tượng, c c ch đặt tên kh c Chẳng hạn, đối tượng mà ... thả cho trôi vào Chi c Hàn Thị nhặt d ưdơcj Về sau, vua thả cung nữ ra, số c Hàn Thị, Hàn Thị lấy chồng, không ngờ chồng nàng Vu Hựu C n hồng (xích thằng) chuyện Vi C đời Đường Một hôm Vi C ...
- 9
- 475
- 0
Bản chất giữa vấn đề dân tộc và vấn đề giai cấp trong tư tưởng Hồ Chí Minh
Ngày tải lên :
18/04/2013, 08:24
... hướng XHCN Đ c điểm bật c ch mạng Việt Nam c ch mạng dân t c dân chủ nhân dân triệt để, tạo tiền đề cho bư c chuyển sang thời kỳ độ lên CNXH; t c là, c ch mạng XHCN bư c cách mạng dân t c dân chủ ... qu c tế, nắm vững thời c , c ch mạng nư c thu c địa thành c ng trư c cách mạng "chính qu c" Một h c lớn c ch mạng Việt Nam h c kết hợp chặt chẽ nhuần nhuyễn đấu tranh giai c p đấu tranh dân t c, ... th c cho quần chúng lao động Người viết: Tiếng c ng hoà, dân chủ b c lột c ng nông, áp thu c địa Tuy khâm ph c cách mạng ấy, Nguyên Ái Qu c cho c ch mạng chưa đến nơi Vì thế, Nguyễn Ái Qu c tích...
- 17
- 655
- 0
Introduction to C++ Programming
Ngày tải lên :
25/04/2013, 19:12
... C+ + Programs: Edit Preprocess Compile Editor Preprocessor Compiler Linker Link Loader Load Disk Execute Disk Program is created in the editor and stored on disk Disk Preprocessor program processes ... Objects can perform actions as well – Inheritance • New classes of objects absorb characteristics from existing classes – Objects • Encapsulate data and functions • Information hiding – Communicate ... object – std::cout – “Connected” to screen –
- 26
- 626
- 0
bài 12: sơ lược mỹ thuật các dân tộc ít người ở Việt Nam
Ngày tải lên :
27/06/2013, 11:46
... t c người Hỏi: Nư c Việt Nam c dân t c anh em? Kể tên số dân t c mà em biết Nư c Việt Nam c 54 dân t c anh em, đoàn kết chống gi c ngoại xâm, bảo vệ XD tổ qu c Mỗi dân t c có nét văn hoá đ c ... kiến tr c? Đa số đặt tháp, trang trí cho tháp, số t c phẩm sáng t c đ c lập Gắn liền với kiến tr c Khối c ng tròn, hình dáng uyển chuyển, gợi c m, động t c mềm mại, nhòp nhàng, bố c c chặt chẽ sinh ... điêu kh c Chăm a Tháp Chăm Hỏi: Tháp Chăm c ng trình kiến tr c đ c trưng dân t c nào? Dân t c Chăm Hỏi: Những đòa phương c tháp Chăm? Quảng Nam, Nha Trang, Phan Rang, Bình Thuận… Hỏi: Em c nhận...
- 30
- 516
- 0
Phân tích luận điểm của Hồ Chí Minh: “ Tất cả các dân tộc trên thế giới đều sinh ra bình đẳng, dân tộc nào cũng có quyền sống, quyền sung sướng và quyền tự do.”. Liên hệ thực tiễn Việt Nam hiện nay.
Ngày tải lên :
24/07/2013, 15:36
... vọng cho ca c dân tô c bị áp bư c thoát khỏi ách thuô c địa của ca c nươ c đế quô c Đó cũng chính là đóng góp vĩ đại của Chủ tịch Hồ Chí Minh đối với ca c dân tô c thuô c ... t c cho đồng thời đ c lập cho tất dân t c Theo Hồ Chí Minh, đô c lập dân tô c trư c hết phải là đô c lập thư c sự, đô c lập hoàn toàn Đô c lập đân tô c là dân tô c đó có đầy đủ chủ ... đến t c động quan trọng nhận th c đ c lập dân t c nư c phát triển Tuy m c tiêu đ c lập dân t c cụ thể nư c, khu v c có kh c nhau, song m c tiêu xuyên suốt tất nư c phát triển c ng c đ c lập...
- 12
- 10.8K
- 79
Tối ưu tốc độ kết nối Internet theo cách đơn giản nhất
Ngày tải lên :
02/08/2013, 01:27
... ̣m chí là cả Dial-up To m la ̣i, TCP ̀ Organizer là tiên ích c c kỳ đơn giản để điề u chinh và tố i ưu tố c đô ̣ kế t nố i Internet Hy vo ̣ng, chương ̣ ̉ trinh sẽ hữu ich cho ... sánh và đố i chiế u ca c kế t quả Tuy nhiên, không hẳ n kế t quả cung c ́ p bởi chương trình đã là chính xa c Chương trinh có thể sử du ̣ng đố i với kế t nố i DSL, cáp quang ... Mô ̣t c ̉a sổ hiên yêu c ̀ u ba ̣n xa c nhâ ̣n lầ n nữa có thư c sự muố n tiế n hành thay đổ i hay không, ba ̣n nhấ n ̣ vào Apply Changes c ̉a sổ này Cuố i cùng, hô ̣p thoa...
- 3
- 373
- 0
8 cách đơn giản tăng tốc windows 7
Ngày tải lên :
13/08/2013, 12:04
... không: c vi c duyệt thư m c dùng chung (shared folders) máy lại chậm máy kh c, cho dù y chang c u hình? Thì c t c vụ lập kế hoạch sẵn (Scheduled tasks) máy tính xí chỗ thư m c chung C ng hên chuyện ... Editor, bạn mở m c HKEY_LOCAL_MACHINE mở dần theo đường dẫn: \SYSTEM\Current ControlSet\Services\fdc Nhấn chọn mở m c fdc Ở phần bên phải, bạn thiết lập m c giá trị c ch nhấp chuột phải lên chỗ ... liệu ổ c ng cho khoảng trống không Để kích hoạt ch c Windows, bạn chọn Start/Programs /Accessories /System Tools /Disk Defragmenter Bạn c n chọn ổ dĩa c ng click nút Defragment để bắt đầu vi c dọn...
- 19
- 440
- 0
Ôn thi Hóa bài 10: Tổng kết nhóm nguyên tố (C,H,O)
Ngày tải lên :
25/08/2013, 05:10
... Monosacarit • (Gucuzơ,Fructoz ơ) •Đisaccarit (Saccarôzơ, •Polisaccarit Mantozơ) (Tinhbột, Xenlulozơ) Ví dụ 1: Một số hợp chất hữu chứa C, H, O c M = 74 đvC CTPT hợp chất hữu C c CTCT c : Bư c ... R’–OH to t Ví dụ 11: Viết phản ứng sau: a CH Cl-COO-CHCl + NaOH b HCOO-CHCl -CH Cl + NaOH to °R–COO–R’ + NaOH R–COONa + R’–OH to °RCl n + nNaOH R-(OH) n + nNaCl to to ° C c phản ứng rượu etylic ... hydrocacbon )m a =? m =? CTTQ đề CTTQ đề Ví dụ 2: C ng th c tổng quát Andehit no, ch c là: A C n H 2n+1 (CHO) C C C n H 2n (CHO B C n H 2n-1 (CHO) 2 D )C n H 2n- (CHO) C n H 2n+2-2a-m (ch c) ...
- 68
- 386
- 0