b and naïve t cell differentiation
Báo cáo y học: "Emerging mechanisms of immune regulation: the extended B7 family and regulatory T cell" pdf
... PDL1/PDL2 Tissue fibroblasts B ICOS - B7 h T MΦ Th T T T B7 .1 /B7 .2 CD28/CTLA-4 T B cell Teff Lymph nodes Neutrophils Teff T cell area Efferent lymphatics TTT B7 x /B7 H3 - ? BTLA? Peripheral tissues ... (PDLs) B7 -H3 and B7 x could be the last-ditch regulators and control the interaction between Teff and the peripheral tissues BTLA, B and T lymphocyte attenuator CD28/CTLA-4: more than just an on/off ... counter-receptor is B and T lymphocyte attenuator (BTLA) [36], because T cells from BTLA-deficient mice fail to bind B7 x-Ig However, receptor binding assays to prove the pairing of B7 x and BTLA...
- 7
- 338
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
... were not detected in the cultures (data not shown) It has been reported that pepsin contamination contributes to the high levels of T- cell reactivity observed in some strains of mouse and rat immunised ... factors that are able to break tolerance via activation of Toll-like receptors The therapeutic profile of CIA in the B6 mouse was similar to that of RA, with a therapeutic action of methotrexate ... with B6 mice, although it remains to be established which cell types are present in the joints of B6 CIA Assessment of lymph node responses showed that in the B6 mouse, both early and late after...
- 8
- 372
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... receptor subfamily D, member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga ... subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology...
- 21
- 376
- 0
Báo cáo y học: " HIV-1 infection and CD4 T cell depletion in the humanized Rag2-/-γc-/- (RAG-hu) mouse model" docx
... post-reconstitution, mice were bled to detect human cell engraftment Peripheral blood cells were stained with different antibodies after RBC lysis and analyzed by FACS (A) Cells stained with antibodies ... human hematopoietic stem cells together with exogenous administration of human cytokines leads to a better engraftment rate A recent breakthrough of even more extensive engraftment without exogenous ... initial experiments evaluated the transplanted mice to verify the levels of human cell engraftment, duration of their persistence, tissue distribution, and the presence of HIV-1 susceptible T cells...
- 14
- 216
- 0
Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc
... tree is not intended to set up a phylogeny but to illustrate the genetic relationships between the isolates III and HTLV-IV isolates have not yet been fully characterized, and their distribution ... acute lymphoblastic leukemia Competing interests The author(s) declare that they have no competing interests Authors' contributions TB designed and performed the laboratory work, particularly the ... EMBL/Genbank/DDBJ nucleotide sequence database (Table 1) These included 13 HTLV-I, 12 HTLV-II, STLV-I, STLV-II, STLV-III, and BLV iso- Table 2: Patient and disease characteristics Disease entity (N)...
- 7
- 428
- 0
Investigations on rab31s role in EGFR trafficking and neural progenitor cell differentiation towards astroglia
... is believed to be important for Rab5 activation, through the recruitment of the RIN1, the Rab5 GEF, to the EGFR-bound Growth factor receptorbound protein (Grb2) and its downstream substrate p21Ras, ... supported the idea that GEFs are integral to the correct targeting of Rabs to membranes Artificial targeting of the Rab5 GEF Rabex5 to the mitochondrial membrane resulted in a concomitant targeting ... in determining the specificity of Rab function b) Rab GTPase activating proteins (GAPs) GAPs terminate the activity of Rab proteins by stimulating the intrinsically low Rab GTPase activity to hydrolyse...
- 186
- 433
- 0
Possible role of diva in microglial dual effects and the stem cell differentiation
... brain-derived neurotrophic factor bFGF basic fibroblast growth factor BH Bcl-2 homology Bid BH3 interacting domain death agonist Bim Bcl2-interacting mediator BMSC bone marrow stem cell Boo Bcl-2 homologue ... tight junction at the vasculature that prohibits the free access of serum components and blood cells to the brain tissue This indicated that the CNS did not have its own intrinsic immune system ... important role during the neural stem cell differentiation, which may lead to identification of the new way to regulate the fate of multipotent stem cells The capability of manipulating the differentiation...
- 185
- 260
- 0
The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization
... Stimulation of transfectant cell lines with TLR4/MD-2, but not TLR4 alone by LPS, results in the activation of the nuclear factor B (NF B) reporter gene Furthermore, cells with TLR4 alone or TLR4 ... 10 functional TLRs that have been identified in human subjects In mouse, 11 distinct TLRs have been described–TLR1–9, 11 and 13 (TLR11 is also called TLR12 by Tabeta et al., (Tabeta K et al., ... cells that have not yet encountered their antigens are known as naїve T cells When they encounter antigen, T cells are induced to proliferate and differentiate into cells capable of contributing to...
- 250
- 384
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
... inhibitory activities of the peptides, the structures of the cyclic peptides were determined by NMR The results proved that the stable b- turn conformation exists in the cyclic peptides The b- turn ... in the b- turn region may be important in the inhibitory mechanism, in addition to the primary structure of the peptide To confirm our hypothesis that the b- turn structures are important for the ... structure is less than A compared to the lowest energy structure in that starting position, that was grouped together with the lowest energy structure forming a cluster of structure The clusters...
- 14
- 657
- 0
Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot
... differential contribution of the CD4+ and CD8+ T- cell subpopulation and suggests that interactions between CD4+ and CD8+ T cells [S9] are critical for T- cell activation and the effects of anti-CD4 ... T- cell reactivity In the present study, the ameliorating anti-CD4 mAbs W3/25 and OX35 (but not the accelerating mAb, RIB5/2) numerically/significantly increased the DTH to the arthritogen M tuberculosis ... capacity of the mAb RIB5/2 [S7,S8] may be attributable to different time points of investigation, different amounts of injected mAb or number of therapeutic injections, and different experimental...
- 14
- 431
- 0
Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx
... chemokines by M-CSF-differentiated monocytes, suggesting that RA synovial T cells possess similarities in their effector function to Tck cells, rather than Ttcr cells It is noteworthy that RA T cells ... competing interests Authors' contributions JTB participated in data analysis, assembly and creation of the figures, and manuscript writing EA contributed to the study design, experimentation, data ... inhibited Normal blood T cells activated 'conventionally' via the TCR with crosslinked anti-CD3 antibody result in TNFα production from monocytes that is unaffected by NF B blockade, but is inhibited...
- 10
- 456
- 0
Báo cáo y học: " Anti-T cell immunoglobulin and mucin domain-2 monoclonal antibody exacerbates collageninduced arthritis by stimulating B cels" pdf
... anti-mouse TIM-2 mAbs (RMT214, RMT2-25, and RMT2-26), which bound to TIM-2 cDNA transfectants but not to those expressing the other TIM family molecules (TIM-1 B6 , TIM-1 BALB, TIM-3 B6 , TIM-3 BALB, and ... by RMT2-25 and RMT2-26, but not by RMT2-14 These results indicated that three mAbs bound to related but different epitopes in the TIM-2 molecule A previous report showed that TIM-2 bound to Sema4A ... stronger blocking activities than RMT2-14 Anti-TIM-2 mAb treatment exacerbates CIA To explore the contribution of TIM-2 to the development of autoimmune arthritis, we first administrated anti-TIM-2...
- 12
- 220
- 0
Characterization of CD137 ligand mediated human monocyte differentiation and their effects on t cell activities
... is that DCs being the most potent APC remain the only cell type that can activate naïve T cells 29 Introduction 1.4.3 DC immunotherapy and its challenges DCs are the most potent APCs that can ... signals to T cells and mount an adaptive immune response (Banchereau and Steinman, 1998) These functional states of DCs make them the most potent APC and also the only cell type that can activate naïve ... New proteins and growth factors should also be tested on their ability to induce DC differentiation 1.4.4 Interactions between T cells and myeloid cells 1.4.4.1 T cell co-stimulation Induction...
- 196
- 491
- 0
Tài liệu Cell Differentiation and Embryonic Development-chua doc pptx
... altering the pattern of gene expression and thus becoming a cell of a particular type is called cell differentiation The zygote is a totipotent cell - its daughter cells can become any cell type ... As the development proceeds, some of the cells become pluripotent - they can become many, but not all cell types Later on, the specificity narrows down further and a particular stem cell can turn ... fingers induce the cell death of the cells between the fingers Similarly, we initially develop more brain cells than we need Those brain cells that establish connections with other nerve cells, muscles,...
- 4
- 401
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
- 20
- 689
- 0
Báo cáo khoa học: SHP-1 dephosphorylates 3BP2 and potentially downregulates 3BP2-mediated T cell antigen receptor signaling ppt
... 3BP2-mediated NFAT activation in response to anti-CD3 stimulation in 3BP2-transfected cells Furthermore, SHP-1 also inhibited the constitutive NFAT activation in 3BP2-transfected cells but not the basal ... NFAT activity in the cells without 3BP2 3BP2-myc WB: anti-myc 62 Fig 3BP2 is dephosphorylated by SHP-1 in activated Jurkat T cells Jurkat T cells were transfected with 3BP2 and SHP-1 or its mutants ... Tris-buffered saline (TBS) (pH 7.6) overnight and then incubated with the first antibodies for h After washing four times with TBS containing 0.05% Tween-20 (TBS -T) , the membranes were incubated...
- 11
- 341
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC ... oligonucleotides specific for the region encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS ... able to stimulate T- lymphocytes bearing Vb5.2 and Vb1 TCRs Similarly, native SSA-2 but not recombinant SSA-2 stimulated T- cells bearing Vb2 [21] Differences in the stimulation properties between...
- 9
- 485
- 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... averaged, and the negative control subtracted The short half-life of 32P necessitated determination of the specific radioactivity of the phosphate at the time of the assay from the Ôtotal radioactivityÕ ... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... where v ¼ the rate of reaction, Vmax ¼ the maximum rate at infinite substrate concentration, S ¼ the substrate concentration, and Km(app) ¼ the Michaelis constant under these conditions From the calculated...
- 8
- 570
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... without IL-2 treatment were subjected to fixation and permeabilization (Fix&PermKit,CaltagLaboratories,Burlingame,CA,USA) and incubated (20 min) with specific rabbit anti-(STAT3/ STAT5) Ig or rabbit ... compartmentation on T cell growth signaling was demonstrated by the remarkably reduced IL-2 stimulated STAT3/STAT5 phosphorylation upon disruption of raft integrity This effect may be brought about by ... al (Eur J Biochem 269) cells, as well (data not shown) No FRET could be detected between CD48 and TrfR either before or after MbCDtreatment on either cell lines, suggesting that the membrane regions...
- 10
- 499
- 0
T-CELL LEUKEMIA CHARACTERISTICS, TREATMENT AND PREVENTION potx
... thymocytes, and its stimulation results in T- cell activation and antigen co-stimulation It also potentiates the physical interaction between T- cells and antigen presenting cells, as well as between T- cells ... density on the malignant T- cells Most antibodies deliver their therapeutic effect by binding to the target on the cell surface, activating complement, antibody dependent cellular cytotoxicity (ADCC) ... clinical activity and an acceptable safety profile in this poor-prognosis patient population, suggesting that the potential benefit combining zanolimumab with standard chemotherapy in the treatment of...
- 148
- 635
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008