auxin as a growth regulator

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢ The 1.6-kbp fulllength Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and the BamHI...

Ngày tải lên: 18/02/2014, 16:20

... Cell Signal 21, 1626–1633 Kurabayashi N, Hirota T, Sakai M, Sanada K & Fukada Y (2010) DYRK 1A and glycogen synthase kinase 3beta, a dual-kinase mechanism directing proteasomal degradation of ... Barallobre MJ, Barhoum R, ´ Fernandez E, Fotaki V, Delabar JM, de la Luna S, de ´ la Villa P & Arbones ML (2008) The protein kinase DYRK 1A regulates caspase-9-mediated apoptosis during retina ... Guimera J, Casas C, Pucharcos C, Solans A, Domenech A, Planas AM, Ashley J, Lovett M, Estivill X & Pritchard MA (1996) A human homologue of Drosophila minibrain (MNB) is expressed in the neuronal...

Ngày tải lên: 22/03/2014, 16:21

... genome (release hg19) accounted for miRNAs annotated in mirBase (release 16) Other small RNA species, such as piwi-interacting RNAs (piRNAs) and small nucleolar RNAs (snoRNAs), were also identified ... correspond to any annotated small RNA Our small RNA cloning strategy only captures small RNAs that are, as miRNAs, 5’-phosphorylated and, Page of 13 thus, eliminates RNA degradation products generated ... renilla and firefly luciferase activities were assayed with the Dual Glo Luciferase Assay System (Promega) and measured with a luminometer (Luminoskan Ascent, Thermo Scientific, Waltham, MA, USA)...

Ngày tải lên: 09/08/2014, 23:20

... Domains (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative ... directly estimated from the relevant data set with no need to assay in parallel a large population of identical d-siRNAs For each average F score from each d-siRNA, the calculated CAsH parameter then ... fhit(x) CAsH was defined as ±fhit(x)/fdata(x) to give an estimate of the expected fraction of hits for each F value; a sign was added to indicate that a hit is a suppressor (-) or an enhancer (+)...

Ngày tải lên: 14/08/2014, 07:22

... PADR1 BRCT WGR Auto-modification Reg Catalytic domain C Catalytic domain Illustration Functional domains of PARP1 Zn—Zinc-binding domains; NLS— Nuclear localization signal; Casp—Caspase cleavage ... by activated PARP1, as PAR can be added onto PARP1 by other members of the PARP family such as the DNA repair enzyme PARP2 PARP1 can also exert its effects as an inactive enzyme For example, acetylation ... repair and transcriptional regulation, it is not surprising that altered PARP1 activity and expression has been associated with several disease states (Table 3) Because the effects of PARP1 as an active...

Ngày tải lên: 10/09/2015, 15:50

... maximum biomass yield of cell suspension culture of ginseng was obtained in medium containing 2,4-D as compared to IBA or NAA However, ginsenoside production was much higher in IBA or NAA containing ... of growth (based on dry weight) in various cultures is shown in (Table 5) It is apparent that growth was inhibited at a high initial N concentration The highest dry weight reached 11.6 g/L at an ... culture maintenance [6] But use of this suspected carcinogen often create health and safety concerns Alterations in the environmental factors such as nutrient levels, light, and temperature may also...

Ngày tải lên: 14/03/2014, 10:20

... CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT ... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom PPP6C-forward PPP6C-reverse 2052 FEBS Journal 278 (2011) ... phase distribution was analyzed by FACS (A) The fraction of cells in G1-phase was significantly increased in the miR-373 ASO group, and the fraction of cells in S-phase was significantly decreased...

Ngày tải lên: 14/03/2014, 23:20

... (5¢-CAGCTGCCCAGAAGAACCGCGAGA TG-3¢, +11 to +36; and 5¢-GAACTCCACGGTGAACC AGT-3¢, +1286 to +1305 bp), DDC-specific primer pair (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, ... Sambrook et al [33] Autoradiogram was analyzed using a BAS-1500 imaging analyzer (Fuji Film, Tokyo, Japan) Production of polyclonal antibody The cDNA fragment containing the ORF of P separata ... radioactivity was counted in a liquid scintillation counter (Aloka LSC5100, Tokyo, Japan) Cloning and sequence analysis of TH cDNA Total RNA was isolated from integuments of day last instar larvae...

Ngày tải lên: 16/03/2014, 11:20

... necrosis mediated by tumor necrosis factor J Exp Med 187, 1477–1485 62 Sasazuki T, Okazaki T, Tada K, Sakon-Komazawa S, Katano M, Tanaka M, Yagita H, Okumura K, Tominaga N, Hayashizaki Y et al (2004) ... early after receptor ligation whereas the cell death regulators FAS-associated via death domain (FADD) and caspase are recruited to a pro-apoptotic complex that forms slowly in the cytoplasm This ... Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C (2010) A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO ⁄ IKKgamma to dampen the host NF-kappaB-mediated inflammatory response Nat Cell Biol 12,...

Ngày tải lên: 28/03/2014, 23:20

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient with growth hormone...

Ngày tải lên: 18/06/2014, 16:20

... Heisterkamp N: Interaction of the small GTPase Rac3 with NRBP, a protein with a kinase-homology domain Int J Mol Med 2002, 9:451-459 13 Bard F, Casano L, Mallabiabarrena A, Wallace E, Saito K, Kitayama ... experimental approaches (in this case genetics and biochemistry) to elucidate protein function Madm was isolated as a BunA-interacting partner by affinity purification and mass spectrometry, and, in parallel, ... phosphorylation BunA is phosphorylated in a conserved amino-terminal domain [14] and this is likely to modulate its activity Identification of kinases and phosphatases that regulate BunA, and examination...

Ngày tải lên: 06/08/2014, 19:21

... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and ... allogeneic organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI 41768, The Nora Eccles Treadwell Foundation, and the Arthritis Foundation-Southern ... Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T: Organ-specific autoimmune diseases induced in mice by elimination of T cell subset I Evidence for the active participation of T cells in natural...

Ngày tải lên: 09/08/2014, 03:24

... heart catheterization A balloontipped pulmonary arterial catheter was advanced to the pulmonary artery for measurement of pulmonary arterial pressure (PAP) and PWP In addition, a plastic catheter ... considered adequate if the patient was able to expectorate at least mL of sputum Statistical analysis All values are presented as mean (SD) Multiple comparisons were performed by one-way analysis of variance ... Endothelial cell death and decreased expression of vascular endothelial growth factor and vascular endothelial growth factor receptor in emphysema Am J Respir Crit Care Med 2001, 163:737-44 Kanazawa...

Ngày tải lên: 12/08/2014, 15:20

... consumption by vasomotion Math Biosci 2004, 191(1):101-108 15 Pradhan RK, Chakravarthy VS, Prabhakar A: Effect of chaotic vasomotion in skeletal muscle on tissue oxygenation Microvasc Res 2007, ... Stansberry KB, Shapiro SA, Hill MA, McNitt PM, Meyer MD, Vinik AI: Impaired Peripheral Vasomotion in Diabetes Diabetis Care 1996, 19:715-721 Intaglietta M: Arteriolar Vasomotion: Implications for Tissue ... estimated capillary transit times in skeletal muscle [abstract] Am J Physiol 1977, 233(1):H122-H129 Bertuglia S, Colantuoni A, Arnold M, Witte H: Dynamic Coherence Analysis of Vasomotion and Flow...

Ngày tải lên: 13/08/2014, 16:20

... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... maintenance, and spread of malignant tumors.[30] The reduction of EGFR may lead to a failure in downstream signal cascades including PI3-K, RAS-RAF-MAPK P44/P42, and protein kinase C pathway, and ... formazan crystals were solubilized by 150 µl of DMSO The absorbance of each well was measured in a microplate reader at 490 nm (A4 90) The percentage of cell growth was calculated by comparison...

Ngày tải lên: 14/08/2014, 19:22

... spatial management strategies such as the establishment of marine protected areas (MPAs) (Gardmark et al 2006) Thus, understanding how growth rate varies across time and space is fundamental ... showed that the mean and variance of traditional biological measurements were higher in MPAs than in non-MPAs, whereas IGF1 levels were also more variable in MPAs than in non-MPAs but mean levels ... multivariable analysis of variance (ANOVA) (PERMANOVA, SUITABILITY OF IGF1 253 FIGURE Location of lingcod collections near Friday Harbor inside and outside marine protected areas (MPAs) Area names are as...

Ngày tải lên: 04/09/2015, 17:15

... inhibition of ataxia telangiectasia mutated (ATM) and ATM and Rad3-related (ATR) protein kinases though detail mechanism has yet being elucidated (d'Adda di Fagagna et al 2003; Takai et al 2003) Telomeres ... have an exposed 53BP1 interaction site thereby activates the DNA damage surveillance pathway TRF2 was proposed as an ATM inhibitor as it was found to be able to physical interacts with ATM at ... telomerase inhibitors They vary in form of screening targets as well as the screening approaches A summary of telomerase targeted cancer therapy and screening that has being published is available...

Ngày tải lên: 02/10/2015, 17:14

... world Tilapia production were Nile Tilapia Production of Tilapia in Vietnam has been increasing year by year; the farming area has been expanded In 2009, the area of tilapia reached 29,717 ha, production ... Tilapia 30 REFERENCES Aguilera-Morales, M., M Casas-Valdez, Carrillo-Dominguez, S., Gonzalez-Acosta, B and Perez-Gil, F., in 2005, chemical composition and microbiological assays of marine algae ... Essential fatty acids of (Tilapia nilotica) Mem Fac Fish., Kagoshima Univ 31: 201-204 Teshima, S., A Kanazawa, and Y Uchiyama 1985 Optimun protein levels in caseingelatin diets for Tilapia nilotica...

Ngày tải lên: 18/11/2015, 19:54

... packages có tên samba rpm –qa samba* => liệt kê packages có tên bắt đầu samba rpm –qa | grep samba => liệt kê packages có tên ch a samba rpm –qd samba => liệt kê files tài liệu liên quan đến samba ... a Cao, Q.1, TP.HCM Tel: (84-8) 38244041 – 0989012418 www.athena.edu.vn - Bạn liệt kê danh sách packages cài đặt (Installed packages) danh sách packages dùng cho bạn download (Available packages) ... (configuration) liệt kê tập tin cấu hình package 3/ Gở bỏ package (Erase): Chú ý: Nếu gỡ bỏ package mà package phụ thuộc vào package khác gỡ bỏ ta dùng thêm tuỳ chọn nodeps  Lỗi package samba-3.0.23c-2.rpm...

Ngày tải lên: 13/09/2012, 10:21

Ngày tải lên: 04/10/2012, 10:24