... estimated to have a dissociation constant in the millimolar range or higher despite the fact that the Km is c 20 lM [37,38] Another difference in the assays is the concentration of the substrate, ... affecting the ability of E1 to catalyse the reductive acetylation of the tethered lipoyl domain in the assembled PDH complex It should be noted that Tyr281 and Arg282 are located at the mouth of the ... any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH complex must be due to direct effects on the reactions catalysed by E1 The falls...
Ngày tải lên: 20/02/2014, 23:20
... Leu 415 in helix 15) A conformational change was also indicated by the MD simulations of the modelled ternary hGK–Glc– ATP complex In the final structure of the simulations, the interactions of the ... mm The fact that the kinetic cooperativity is dependent on the MgATP concentration is consistent with previous data reported for the rat liver isoform [33,34] With MgATP as the variable substrate, ... simulations of the modelled binary GK–ATP complex revealed that the global rmsd of the structure converged at the end of the 2-ns simulation period (Fig S2A) The dynamic changes in the active site cleft...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km m-Anisyl alcohol p-Anisyl alcohol Veratryl alcohol 2,4-Hexadien-1-ol 632 ± 158 ... are situated at similar distances from the hydroxyl of the docked substrate, they could cooperate in facilitating the hydride transfer from substrate to FAD The decrease of activity of the AAO ... where A is the maximal turnover rate (kcat), X is the substrate concentration, K is the Michaelis constant (Km), and B is the catalytic efficiency (kcat ⁄ Km) Mean and standard deviations were...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... network of interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance to the active site pocket of Exg is flanked ... with the protein Two of these water molecules coincide with the C2-OH and C3-OH groups in native Exg, whereas the third occupies the space created by the E292S mutation This situation provides the ... towards aromatic triads that can accommodate the twists specifically associated with b-1,3-glucan polymers The nature of the aromatic residues in the two triads might then be reflecting the different...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
... with the substituent on the amino moiety of the substrate, confirming that the formation of acyl enzyme (AE) is the rate-limiting step of the reaction The Hammett plot of log(kcat,R ⁄ kcat,H) ... phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active site during catalysis Phenylacetic ... active site was constructed It illustrates the reorganization of the hydrogen bond network at the active site, which predetermines the catalytic transformations Several functional groups in the...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... which is the fractional decrease of phosphorylation rate seen at the concentration x of H4biopterin vo is the rate in the absence of H4biopterin and vmin is the rate at very high concentrations ... suggested the presence of several putative binding sites for the natural cofactor H4biopterin The proposed binding sites are a regulatory site (outside the active site) that is responsible for the ... bidentate coordination to the active site iron [17] Whereas the inhibition of the catalytic activity by catecholamines is well understood at the structural level [17], the molecular mechanism of the...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic ... allowed the identi®cation of the active site carboxylate The predicted derivatives were located exclusively on glutamate 324, which led us to conclude that this residue is the active site carboxylate ... preparation These data indicated that a small but signi®cant fraction of the puri®ed CoA-transferase was trapped as the enzyme-CoA thiol ester intermediate It has been Site- speci®c label of the catalytic...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt
... ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC ... velocity Specifically, the rate for the C54S mutant was 60% of that of the wild-type, and the relative rates of the C65S and C67S mutants were in the range 10–20% It follows that the zinc ion is not ... tetrahydrofolate pathway start from GTP (Fig 1) The first step of each pathway involves the hydrolytic opening of the imidazole ring of the substrate with formation of formate as a byproduct However, the...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... whether this inactivation is due to the presence of a lysine residue specifically at the active site of the enzyme of normal sources Moreover, preliminary evidence has indicated that the catalytic ... concentration of PP The rabbit muscle enzyme could be inactivated to the extent of about 60% with mM PP in 15 The rate of inactivation of the EAC enzyme was a function of the reagent concentration ... present in the active site of rabbit muscle Gra3P DH All these studies convincingly demonstrate that the loss of the enzymatic activity on treatment with TNBS was due to the modification of a...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx
... are the decay velocity and the decay the charge separated state that is generated in the RC velocity distribution, respectively) The ratio C/B repfollowing the absorption of a photon in the absence ... that the ligand in the binding 53 result larger than the same rate for the oxidized form: (kout)QH2 ‡ (kout)Q Conversely, from the hypothesis that channel, either taken up or released, moves at ... that the charge separated and neutral RCs ratio as small as three, the QB site was fully occupied When exchange quinones with the same kinetics, regardless of the the electron reaches the QA site...
Ngày tải lên: 30/03/2014, 20:20
cobble circles and standing stones archaeology at the rivas site costa rica mar 2004
... placed a x meter pit that traversed the wall of the structure at its northeast side In neither location were post molds found It may be that the nature of the soils at the site does not preserve ... distance The Rivas site is on the other side of the ridge, while the town of Rivas is on the far left from the foothills On one side of the ridge lies the modern town of Rivas and on the other, the ... cream At other times, the clouds form before your eyes, rising out of the forest in long, feathery trails The highest part of the road passes by the Cerro de la Muerte, the Mountain of Death, at...
Ngày tải lên: 11/06/2014, 14:34
Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf
... N-saturated stands However, even fertilisation with N fertilizers did not increase N concentrations in the needles at the Hửglwald to a signicant extent [19] At our site it could be shown that the ... DISCUSSION The concentrations of N, P, K, and Mg were generally higher in the current needles than in the older needles at the Hửglwald site The opposite was observed for Ca, Mn and Al, while the Fe ... trend The K concentrations at the Hửglwald site were mostly lower than at other spruce stands in Europe [29, 43] In some years the K concentrations at the Hửglwald site were classied as very...
Ngày tải lên: 07/08/2014, 16:20
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"
... in the acetabulum cup The solution for this problem is to improve the femoral fixation of the spacer stem Alternatively to that and at stable femoral fixation, the spacer itself may dislocate ... elegant method that treats both the fracture and the infection (Figure 8) At the time of prosthesis reimplantation, the spacer head can be easily removed and the modular prosthesis parts (neck ... an unstable joint situation results, the outcome of the surgery is endangered or the mobilisation of the patient is hereby limited Generally, the surgical treatment of these fractures should...
Ngày tải lên: 26/10/2012, 09:53
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... including transcription attenuation at the putative hairpin structure of precursor RNA (at the 5¢ end of the tRNALeu gene) have been proposed for the partial termination at the end of the rRNA genes [32,33] ... transcript terminating at mt-TERM [15, 16], while the discontinuous outer arrow indicates the promoter distal transcript terminating at D-TERM sites (B) Schematic representation of the mouse mt D-loop ... ending at nucleotide 16 295 of the genome ([20] see Fig 1) Since the RNA is polyadenylated, it is uncertain if the termination occurs at the C residue at 16 293 or the A residue at 16 295 of the...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot
... of the cytosine, which leads to the formation of a covalent bond between the enzyme and the substrate base The formation of the cysteine–cytosine bond increases the negative charge density at the ... substrate abolished the tritium incorporation into the MTase but at the same time the DNA got efficiently methylated This result illustrates that after binding both substrates (DNA and AdoMet) the ... Dnmt3a colored by atom type The distance between the sulfhydryl atom of the catalytic cysteine side chain and sulfur ˚ atom of AdoHcy (7.66 A) is indicated On the other hand, they harbor a cysteine...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Low U1 snRNP dependence at the NF1 exon 29 donor splice site doc
... New site New site New site New site New site New site New site Site broken Site broken New site New site New site New site New site Site broken New site Site broken New site Site broken Site ... New site Site broken New site New site Site broken Site broken Site broken Site broken Site broken Site broken New site Site broken New site New site New site Site broken Site broken New site Site ... sequence, using the following oligonucleotides: NF29-F, 5¢-ttcattcatatgaccatttgaatatacaatggt-3¢; and NF29-R, 5¢-aagtaacatatgatggagaaaggacatatat-3¢ Both oligonucleotides carry an Nde1 site in their 5¢-ends,...
Ngày tải lên: 16/03/2014, 01:20
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt
... being narrower at the top than at the bottom; so that what with their form and their own shrinking, they only need a little shaking, and out they fall In the same way are made these candles of ... cotton and get to the top; other particles then follow by their mutual attraction for each other, and as they reach the flame they are gradually burned Here is another application of the same principle ... kept the heat applied to it, it would have burst the vessel; yet, when the steam returns to the state of water, the vessel collapses, there being a vacuum produced inside by the condensation of the...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: Roles of adenine anchoring and ion pairing at the coenzyme B12-binding site in diol dehydratase catalysis pptx
... Lysb135 mutant diol dehydratases Table indicates that kcat values of the Kb135R, Kb135A and Kb135Q mutants were 58–76% that of the wild-type enzyme at saturating concentrations of FEBS Journal 275 ... incubation with the Sa224A mutant for 30 in the presence of substrate In contrast, the spectral change of AdoCbl upon incubation with the Sa224N apoenzyme was rather small even at 30 of incubation ... incubation with substrate at °C for (Fig 5B) This indicates that the steady-state concentration of an organic radical intermediate is very low with the Sa224A mutant, which is consistent with the...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx
... while ADP binds to the catalytic site The fourth possibility is that Pi binds to the noncatalytic sites (or any other site) and inhibitory ADP is ejected from the catalytic sites The last possibility ... that Pi competes with ATP at the second catalytic site It may imply that the ®rst site favors ATP binding whereas the second site favors Pi binding Preferred binding of substrate or product at ... 5A,B, MgATP binding was fast in the absence of phosphate, but slow in the presence of 10 mM phosphate at appropriate MgATP concentrations At 200 nM MgATP, the binding was slowest When MgATP was...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... Our novel data demonstrate that the )1CfiA mutation at the transcriptional initiation site is causative, which regulates b2GPI gene expression at the transcriptional level that ultimately affects ... with the )1CfiA mutation Alternatively, other genetic or nongenetic factors modulate the effect of the )1CfiA mutation on b2GPI plasma levels We also found that the )1CfiA mutation cannot explain the ... effect on the regulation of b2GPI expression The functional characterization of the b2GPI promoter would enable the targeting of regulatory regions for mutation detection Further evidence that the...
Ngày tải lên: 31/03/2014, 07:20