as a specific version of the international classification of diseases

... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... an east Indian patient, and one from an oriental patient The racial background of four patients was not known Of these patients, 13 were male and 86 female (in two the sex was unknown), and the...

Ngày tải lên: 09/08/2014, 06:22

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... feasibility of translating these therapies to humans remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the ... to assess the effects and benefits of this double therapy Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is the...

Ngày tải lên: 18/06/2014, 16:20

... Ontario Physiotherapy Association to Ravi Rastogi 20 21 The study was completed by Ravi Rastogi in partial fulfilment of the requirements for the degree of Master of Science at the School of ... RR, AMD and BMC designed the study RR collected and analyzed the data and drafted the manuscript with regular feedback from AMD and BMC All authors read and approved the final manuscript 18 19 Acknowledgements ... work was supported by a Premier's Research Excellence Award from the Ontario Ministry of Health and Long-term Care to Dr Davis and by the Dr Jal Tata Research Award from the London district of the...

Ngày tải lên: 18/06/2014, 19:20

... factors’; the latter are not classified in the ICF because of the large social and cultural variance associated with them The units of the ICF classification are called categories; they are organized ... comparison of all the measures’ contents for the choice of instruments in the field of haemophilia In addition to the International Classification of Diseases (ICD-10) [34], the World Health Organisation ... problems walking downstairs” from the HEP-TestQ asks about the impact of the disease for a specific action of walking From a methodological point of view, while the quality of linking was assured, the...

Ngày tải lên: 20/06/2014, 15:20

... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of...

Ngày tải lên: 26/10/2012, 10:03

... which has traded on average about basis points below the Bank Rate over this period, occasionally falling below the Bank Rate by as much as 35 basis points Bank of Canada The Bank of Canada (BoC) ... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European...

Ngày tải lên: 17/02/2014, 03:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... the formate flux and Clas Jacetate Clas % ðÀ0:4Þ for the acetate flux 2295 Control analysis of the las operon B Koebmann et al Fig Construction of a strain with the pyk gene deleted from the las ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

Ngày tải lên: 19/02/2014, 17:20

...  (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per ... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... allocated for the provision of obstetric anesthesia services The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants of obstetric anesthesia...

Ngày tải lên: 05/03/2014, 15:20

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...

Ngày tải lên: 06/03/2014, 01:20

... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...

Ngày tải lên: 07/03/2014, 10:20

... present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular ... Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after ... steady-state fluorescence anisotropy was measured as in [45] When the temperature dependence of fluidity was followed, the temperature was gradually (0.4 °CÆmin)1) increased and the anisotropy data...

Ngày tải lên: 07/03/2014, 12:20

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...

Ngày tải lên: 07/03/2014, 15:20

... Tularaemia A2 1.0 Ulceroglandular tularaemia A2 1.0X Oral manifestations A2 1.8 Other forms of tularaemia A2 1.8X Oral manifestations Anthrax A2 2.8 Other forms of anthrax A2 2.8X Oral manifestations ... consisting of a relatively small number of broad headings, or in an expanded form that allows detailed analysis in areas of special interest The International Classification of Diseases Readers and ... Library Cataloguing in Publication Data Application of the International Classification of Diseases to dentistry and stomatology: ICD-DA — 3rd ed 1.Mouth diseases — classification 2.Mouth neoplasms...

Ngày tải lên: 15/03/2014, 11:20

... of the wastewater  problems near shrimp ponds. These are:  (i)  Spatial  boundaries:  the location  of the shrimp  farms  has  to  stay  nearby  the river  estuaries;  The available  space  ... environment [3]. One of the disadvantages is  that  the relative  importance  of evaluation  criteria is determined without considering the scales  on  which  the criteria  are  measured.  Another disadvantage is the large amount of ... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of them are introduced as follows. ...

Ngày tải lên: 22/03/2014, 12:20

... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade...

Ngày tải lên: 22/03/2014, 16:20

... refinement of) Ruzsa’s analogue of Freiman’s theorem, which gives a fairly strong characterisation of subsets A ⊆ Fn satisfying a small doubling condition |A + A| K |A| An analogue of this theorem for any ... suppose that there are at least δ |A| 3 additive quadruples (a1 , a2 , a3 , a4 ) in A4 with a1 + a2 = a3 + a4 Then there is a regular Bourgain system S satisfying dim(S) Cδ −C ; |S| e−Cδ −C |A| and ... , was obtained in [12] The argument there, which was a combination of [12, Lemma 3.4] and [12, Prop 3.7], was somewhat elaborate and involved polynomials which are small near small integers The...

Ngày tải lên: 22/03/2014, 20:21

... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae Higher ... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢),...

Ngày tải lên: 23/03/2014, 15:21

... since these questions ask about aspects of participation The ICF classification was then used to assign ICF categories to the meaningful concepts In the ICF classification the components are labeled ... the ICF (e.g suicide attempts) it was coded as 'not covered' [8] A meaningful concept was coded as a 'personal factor' if it asks about age or other factors that relate to the background of the ... in the International Classification of Functioning, Disability and Health (ICF) as the 'involvement in a life situation' and participation restrictions are defined as 'problems an individual may...

Ngày tải lên: 18/06/2014, 19:20

... by a native English speaker We repeated back-translations and made further modifications until a consensus was reached The second step was to examine whether the HSF-36 Chinese version has an appropriate ... Inc., Chicago) was used for data analysis and the significant level was set up at p < 0.05 An intra-class correlation (ICC) approach was used to examine the test-retest reliability of HFS-36 ... SF-36, HFS-36 scale was sensitive and specific to evaluate the mental health in HFS, such as the stigma and embarrassment Moreover, HFS-36 also detected the impact to physical health, like difficulty...

Ngày tải lên: 18/06/2014, 19:20

... interview All the patients reported clarity of the Hausa language and ease of understanding of all the items The final version of the Hausa translation of IKHOAM (see Additional file 2) The anchors (English) ... of IKHOAM The divergent validity of the Hausa version of IKHOAM was analyzed by subjecting participants' scores on the Visual Analogue Scale and the Hausa version of IKHOAM to Spearman rank Order ... correlation Internal consistency of the parts of the Hausa version of IKHOAM was calculated using the Cronbach's alpha Level of significance was set at 0.05 The SPSS 12 software program was used...

Ngày tải lên: 18/06/2014, 19:20