arsenic in the environment a global perspective

Heavy Metals in the Environment - Chapter 10 pps

Heavy Metals in the Environment - Chapter 10 pps

... concentration is about 0.5% of that in the plasma The citrate/transferrin ratio is 2.0 in the plasma and Ͼ720 in the cerebrospinal fluid Thus in cerebrospinal fluid Al(III) exists mainly as a citrate complex, ... from the earliest available annual average Al concentrations, taken at monthly intervals, for municipalities participating in a Drinking Water Surveillance Program conducted by the Ontario Ministry ... milligram quantities of Al consumed daily in food and drinking water In a study of epidemiological aspects of Alzheimer’s disease in 1984, Heyman et al reported that the intake of Al-containing antacids...

Ngày tải lên: 11/08/2014, 15:20

40 269 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

... cross-linking assay, the samples were incubated at room temperature, as described above for the EMSA assay, and then irradiated at 302 nm for 10 using a transilluminator (Bio-Rad Laboratories) The ... accompanied by a dramatic increase in protein methylation at as many as nine lysine residues, without any change in the protein or mRNA levels [43] This modification, as well as other post-translational ... molecular nature in normal and cancer cells, we performed a comparative bidimensional PAGE analysis of nuclear extracts coupled to Western blotting analysis with an eEF 1A mAb As an internal normalizer...

Ngày tải lên: 21/02/2014, 00:20

12 552 0
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt

Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt

... a random sequential model, values for Km,ATP, Km,GST-IjBa, Vmax and a was determined from the global t The constant a is the ratio of apparent dissociation constants for binding GST-IjBa in the ... performed using the same protocol as that described for the kinase time-course assay The assay was again repeated with the inclusion of 10 mm MnCl2 in the kinase condition In vitro analysis of ... function in gepasi The mathematical model described here has been submitted to the online Cellular Systems Modeling Database and can be accessed at http://jjj.biochem.sun.ac.za/database/ihekwaba/ index.html...

Ngày tải lên: 16/03/2014, 11:20

13 475 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC ... GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...

Ngày tải lên: 29/03/2014, 21:20

16 462 0
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice 2

Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice 2

... predicted amino acid sequence revealed an amino-terminal SH2 domain, a central 5’phosphatase domain, two NPXY sequences and a proline rich C-terminal tail This protein was named SH2-containing inositol ... Behring and Shibasabo Kitasato in Koch’s laboratory discovered that injecting diphtheria toxin into animals produces a serum containing an antitoxin that provided passive antidiphtheria immunity ... BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen Santa Cruz BD Pharmingen BD Pharmingen Santa Cruz Sigma Santa Cruz...

Ngày tải lên: 14/09/2015, 09:08

132 329 0
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice

Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice

... signaling Both adaptors act as negative regulators of Ras and mitogen activated protein kinase vi (MAPK), in particularly Extracellular signal-regulated kinases (Erk) Dok-1 and may exert their inhibitory ... Keong, Kar Wai, Andy, Valerie, Ann Teck, Jianxin and Koon Guan for sharing reagents and meaningful discussion about science and the companionship for the past years Weng Keong, thanks for managing ... protein kinase kinase Mitogen activated protein kinase kinase kinase Major histocompatibility complex Macrophage colony-stimulating factor Muscle-specific receptor kinase Nuclear factor κB Pathogen-associated...

Ngày tải lên: 14/09/2015, 10:44

16 229 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... zymogenicity of free FVIIa are as interesting as those involved in the TF-induced allostery Amino acid residues in FVIIa that are involved in the conformational balance that governs the equilibrium between ... Biaevaluation 4.1 supplied by the manufacturer (Biacore AB) N-terminal pegylation and carbamylation In the pegylation experiments, G37 2A- FVIIa and FVIIa at a concentration of 10 lm, alone or after ... Inc., San Diego, CA, USA) The model of G37 2A- FVIIa was created by mutating the side chain in FVIIa taken from the FVIIaặTF structure [9] (Protein Data Bank accession number 1dan) using the mutation...

Ngày tải lên: 18/02/2014, 08:20

11 619 0
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

... 420, 422 and 428 aa; nine aa in total) were located near the interface of the physiological dimer The Cterminal domain may contain structural features involved in protein–protein interactions ... are shown as cylinders The ‘lid’ (26-29 aa) is shown in magenta Fig C-terminal domains in the F, N, G, T and TG structures The backbone atoms of the C-terminal domain (1-305 aa) in the F (black), ... l-glutamate in an extended form ˚ (Fig 7A) with a contact area of 288 A2 Asparaginase binds l-glutamate in a folded form (Fig 7B) in an apparently much smaller pocket with a contact area of ˚ 233 A2 These...

Ngày tải lên: 06/03/2014, 09:22

11 522 0
Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

... throughout the preparation SILAC: sample preparation Human cervical carcinoma (HeLa) cells were grown in Dulbecco’s modified Eagle’s medium containing ‘light’ arginine and lysine or 13C6-arginine and ... emerin Remarkably, this site is at the primary structure level far away from the N-terminal LEM-domain that is thought to mediate this interaction [40] Lamin -A binding has been mapped to the ... carboxy-terminal amino-acid residues, respectively) The SILAC approach (Fig 3A) is based on in vivo labeling of all the cellular proteins by isotope-coded amino acids In addition, we used the determination...

Ngày tải lên: 07/03/2014, 12:20

12 429 0
Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx

Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx

... 5¢-ACAATGAGCTGCTGGTGGCT-3¢ and 5¢-GATGGGCACAGTGTGGGTGA-3¢; murine b-actin, 5¢-TGGAATCCTGTGGCATCCATGAAAC-3¢ and 5¢-TA AAACGCAGCTCAGTAACCGTCCG-3¢ Human GAPDH primers were included in the Advantage ... peptone-activated and IFNc-activated macrophages exhibited increased arginase activity and were resistant to HSV infection by a mechanism that was prevented by the addition of arginine, suggesting an ... manner ArgII is a mitochondrial enzyme involved in the polyamine synthesis pathway through the catalysis of l-ornithine production from l-arginine Of the natural polyamines, spermine and to a...

Ngày tải lên: 07/03/2014, 21:20

12 498 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... hydratase 3-Ketoacyl-CoA thiolase Perilipin GGTTGT gtagg AGTTCA AGGACA a AGGTCA AGGTAG a AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] ... released from activated platelets, monocytes and damaged vessel walls and plays a central role in the dynamic regulation of vascular haemostasis [23] Alterations in the level of TXA2, TXA2 synthase ... individual PPARc2 or RXRa proteins, binding was substantially increased following coincubation with both the PPARc and RXRa proteins with the radiolabelled PPARc ⁄ RXR probe B On the other hand,...

Ngày tải lên: 07/03/2014, 21:20

20 432 0
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

... considerable evidence implicating GSK3 in the regulation of glycogen metabolism there are conflicting reports in the literature as to whether the kinase also participates in the hormonal activation ... phosphatidylinositol 3-kinase, p70, S6 kinase and glycogen synthase kinase-3 activity in L6 muscle cells: evidence for the involvement of the mammalian target of rapamycin (mTOR) pathway in the L-leucine-induced ... Kono-Sugita, E., Sekihara, H., Aizawa, S., Cushman, S.W., Akanuma, Y., Yazaki, Y & Kadowaki, T (1997) Role of insulin receptor substrate-1 and pp60 in the regulation of insulin-induced glucose transport...

Ngày tải lên: 08/03/2014, 08:20

10 805 0
Báo cáo " DENOTING THE NUCLEAR ISOTOPES IN EXPERIMENTAL GAMMA SPECTRUM" pptx

Báo cáo " DENOTING THE NUCLEAR ISOTOPES IN EXPERIMENTAL GAMMA SPECTRUM" pptx

... are in the spectrum Fig The flowchart of the isotope making the experimental gamma spectrum 48 Nguyen Trung Tinh Each isotope is loaded in the memory and its informations are contained in a structure ... }; The informations of whole spectrum are expressed in a dynamical linked namelist, whose each component is a structure containing the infomations of an energy level The exhibit of the information ... in order to load gamma energy spectrum into the memory of computer and make a dynamical linked namelist performing the spectrum, then a loop is worked for checking if these nominal isotopes are...

Ngày tải lên: 14/03/2014, 13:20

6 203 0
Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

... 5¢-GACCTGCTTCCCGATGACTTT-3¢ and antisense, 5¢-TTCCTCCAACCACAGCACATAC-3¢); UBC9 (sense, 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ and antisense, 5¢-GCATCCGTAGCTTGAACAAGCCTC-3¢); PIAS3 (sense, 5¢-ACTGCAGGGACCCTGCTACA-3¢ ... CYP1 1A1 (sense, 5¢-GAGAATCCAGCTTCTTTCCC-3¢ and antisense, 5¢-GGCGACACTGTATGAATTGC-3¢); SENP2 (sense, 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢); SAE1 (sense, 5¢-GACCTGCTTCCCGATGACTTT-3¢ ... suggesting that activation of the cAMP pathway may have a positive regulatory effect on LRH-1 activity In response to pituitary gonadotropins, the cAMP signaling pathway is the most important pathway...

Ngày tải lên: 23/03/2014, 06:20

12 443 0
FUTURE OF THE NUCLEAR SECURITY ENVIRONMENT IN 2015 pptx

FUTURE OF THE NUCLEAR SECURITY ENVIRONMENT IN 2015 pptx

... regulations in the area as a basis, and in close cooperation with the DOE national laboratories NUCLEAR MATERIALS BALANCE ZONES In 1995-1996, analysis of the main characteristics of all the nuclear materials ... countries and the international community in general sought to strengthen and maintain the non-proliferation regime Acting in these interests, the United States offered financial and technical assistance ... deterring aggression, ensuring security of Russia and its allies, and maintaining international peace and security In other words, nuclear weapons are still looked to as the main guarantors of national...

Ngày tải lên: 29/03/2014, 18:20

324 504 0
Báo cáo khoa học: The in vitro nuclear aggregates of polyamines pot

Báo cáo khoa học: The in vitro nuclear aggregates of polyamines pot

... unimers in a linear chain, rather than their columnar stacking, if the hydrogen bonds are single and arranged in a chain [3] The data reported here concerning the ivNAPs support this belief, as a linear ... estimated by integrating the peak area of the GPC chromatograms (Fig 1) obtained from the separation of polyamine solutions prepared by changing the concentration of a single polyamine and keeping ... genomic DNA Therefore, our data indicate that: (a) the latter is a typical attribute of both NAPs and their in vitro equivalents; and (b) the ivNAPs, similarly to the cellular analogs, are able to...

Ngày tải lên: 29/03/2014, 23:20

12 247 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... kDa form (71 kDa in the recombinant insectproduced form) The appearance of an intermediate molecular form can also be seen as a 74 kDa protein Both C-terminal cleavages were proposed to be accomplished ... expressing the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper ... Bernard N, Kitabgi P & Rovere-Jovene C (2003) The Arg617–Arg618 cleavage site in the C-terminal domain of PC1 plays a major role in the processing and targeting of the enzyme within the regulated...

Ngày tải lên: 30/03/2014, 08:20

10 305 0
báo cáo hóa học:" yuDetecting the percent of peripheral blood mononuclear cells displaying p-STAT-3 in malignant glioma patients" pot

báo cáo hóa học:" yuDetecting the percent of peripheral blood mononuclear cells displaying p-STAT-3 in malignant glioma patients" pot

... various stages of preclinical and clinical trial testing A limitation of this assay is that an increase in the mean percentage of PBMCs displaying p-STAT-3 was not detected in all cases of malignant ... growth and increased malignancy In many malignancies, the signal transducer and activator of transcription (STAT-3) plays an integral role in modulating oncogenesis, inhibiting apoptosis, and suppressing ... GNF, and ABH participated in data collection, and WH, YW, WQ, CR-O, JW, GFN and ABH participated in the data analysis and the interpretation of results WH, YW and ABH contributed to the writing...

Ngày tải lên: 18/06/2014, 15:20

9 462 0
Báo cáo sinh học: " Strategically examining the full-genome of dengue virus type 3 in clinical isolates reveals its mutation spectra" ppt

Báo cáo sinh học: " Strategically examining the full-genome of dengue virus type 3 in clinical isolates reveals its mutation spectra" ppt

... CMT TCA CCA AAG AGT CTA GCT GGT CC CAT TGT GCG TCA ACA CTG CC AGC TGG CCA CTG AAT GAG G CAA AAG TCT TCC TAC TAA GTT G GCC GCA ATT TTC ATG ACA AAC AGC TAT CGT GGT GTT CC AAG AAT CCA ACG GTG GAT GG ... close examination of the overlapping chromatogram files using the SeqMan program in the Lasergene software package (DNASTAR inc., Madison, WI) Special attention was paid to identify the regions ... viral isolates 3H was caused by the value of of dS at the denominator The positive selection on the domain III is not surprising since domain III contains the receptorbinding domain and major type-specific...

Ngày tải lên: 19/06/2014, 08:20

10 361 0
w