arrival at the incident site

Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

... estimated to have a dissociation constant in the millimolar range or higher despite the fact that the Km is c 20 lM [37,38] Another difference in the assays is the concentration of the substrate, ... affecting the ability of E1 to catalyse the reductive acetylation of the tethered lipoyl domain in the assembled PDH complex It should be noted that Tyr281 and Arg282 are located at the mouth of the ... any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH complex must be due to direct effects on the reactions catalysed by E1 The falls...

Ngày tải lên: 20/02/2014, 23:20

10 459 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

... mm The fact that the kinetic cooperativity is dependent on the MgATP concentration is consistent with previous data reported for the rat liver isoform [33,34] With MgATP as the variable substrate, ... molecular motion was further indicated by the dyndom algorithm [30], with the coordinates obtained for the ligand-free form and the hGK–ATP complex at the end of the simulations (Figs 6B,C and ... simulations of the modelled binary GK–ATP complex revealed that the global rmsd of the structure converged at the end of the 2-ns simulation period (Fig S2A) The dynamic changes in the active site cleft...

Ngày tải lên: 06/03/2014, 00:20

15 374 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot

Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot

... are situated at similar distances from the hydroxyl of the docked substrate, they could cooperate in facilitating the hydride transfer from substrate to FAD The decrease of activity of the AAO ... kcat kcat ⁄ Km Y78A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km m-Anisyl alcohol p-Anisyl alcohol Veratryl alcohol 2,4-Hexadien-1-ol ... H546R GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC...

Ngày tải lên: 07/03/2014, 11:20

11 471 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

... network of interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance to the active site pocket of Exg is flanked ... with the protein Two of these water molecules coincide with the C2-OH and C3-OH groups in native Exg, whereas the third occupies the space created by the E292S mutation This situation provides the ... towards aromatic triads that can accommodate the twists specifically associated with b-1,3-glucan polymers The nature of the aromatic residues in the two triads might then be reflecting the different...

Ngày tải lên: 15/03/2014, 23:20

13 498 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

... with the substituent on the amino moiety of the substrate, confirming that the formation of acyl enzyme (AE) is the rate-limiting step of the reaction The Hammett plot of log(kcat,R ⁄ kcat,H) ... phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active site during catalysis Phenylacetic ... active site was constructed It illustrates the reorganization of the hydrogen bond network at the active site, which predetermines the catalytic transformations Several functional groups in the...

Ngày tải lên: 16/03/2014, 01:20

10 425 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx

... which is the fractional decrease of phosphorylation rate seen at the concentration x of H4biopterin vo is the rate in the absence of H4biopterin and vmin is the rate at very high concentrations ... suggested the presence of several putative binding sites for the natural cofactor H4biopterin The proposed binding sites are a regulatory site (outside the active site) that is responsible for the ... bidentate coordination to the active site iron [17] Whereas the inhibition of the catalytic activity by catecholamines is well understood at the structural level [17], the molecular mechanism of the...

Ngày tải lên: 17/03/2014, 09:20

10 471 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

... generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic ... allowed the identi®cation of the active site carboxylate The predicted derivatives were located exclusively on glutamate 324, which led us to conclude that this residue is the active site carboxylate ... preparation These data indicated that a small but signi®cant fraction of the puri®ed CoA-transferase was trapped as the enzyme-CoA thiol ester intermediate It has been Site- speci®c label of the catalytic...

Ngày tải lên: 17/03/2014, 17:20

9 499 0
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt

Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt

... ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC ... velocity Specifically, the rate for the C54S mutant was  60% of that of the wild-type, and the relative rates of the C65S and C67S mutants were in the range 10–20% It follows that the zinc ion is not ... tetrahydrofolate pathway start from GTP (Fig 1) The first step of each pathway involves the hydrolytic opening of the imidazole ring of the substrate with formation of formate as a byproduct However, the...

Ngày tải lên: 23/03/2014, 21:20

7 367 0
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt

Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt

... present in the active site of rabbit muscle Gra3P DH All these studies convincingly demonstrate that the loss of the enzymatic activity on treatment with TNBS was due to the modification of a ... interaction with the substrate binding site of the enzyme, even at higher concentrations failed to protect the enzyme activity against TNBS or PP inactivation The small amount of the substrates GraP ... properties Therefore, in this paper we investigated the amino-acid residue(s) that are critically involved at the active site of the EAC cell enzyme and whether there is any difference between the malignant...

Ngày tải lên: 24/03/2014, 04:21

8 284 0
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx

Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx

... are the decay velocity and the decay the charge separated state that is generated in the RC velocity distribution, respectively) The ratio C/B repfollowing the absorption of a photon in the absence ... that the ligand in the binding 53 result larger than the same rate for the oxidized form: (kout)QH2 ‡ (kout)Q Conversely, from the hypothesis that channel, either taken up or released, moves at ... that the charge separated and neutral RCs ratio as small as three, the QB site was fully occupied When exchange quinones with the same kinetics, regardless of the the electron reaches the QA site...

Ngày tải lên: 30/03/2014, 20:20

11 365 0
cobble circles and standing stones archaeology at the rivas site costa rica mar 2004

cobble circles and standing stones archaeology at the rivas site costa rica mar 2004

... placed a x meter pit that traversed the wall of the structure at its northeast side In neither location were post molds found It may be that the nature of the soils at the site does not preserve ... distance The Rivas site is on the other side of the ridge, while the town of Rivas is on the far left from the foothills On one side of the ridge lies the modern town of Rivas and on the other, the ... rare The fact that the cobble was placed with the petroglyph side up, however, suggests that the design was appreciated Since other petroglyphs are found at the site, it is likely that the design...

Ngày tải lên: 11/06/2014, 14:34

233 321 0
Báo cáo hóa học: " Low temperature of radiofrequency ablation at the target sites can facilitate rapid progression of residual hepatic VX2 carcinoma" pdf

Báo cáo hóa học: " Low temperature of radiofrequency ablation at the target sites can facilitate rapid progression of residual hepatic VX2 carcinoma" pdf

... than that in the control group (12.63 ± 1.87 cm ) It seemed that the lower the temperature of RFA was, the larger the tumor volume was (Fig 3) Effects of low temperature of RFA at the target sites ... of the lung B Fractionated view of the lung, which has been magnified to show the details of the metastatic nodules group (Fig 7) The lower the target temperature of RFA was, the higher was the ... for HCC The real ablative temperature of the tumor might be nearer to the target temperature, compared with the clinical situation This was why we chose 85°C as the highest RFA temperature At present,...

Ngày tải lên: 18/06/2014, 16:20

10 376 0
Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf

Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf

... N-saturated stands However, even fertilisation with N fertilizers did not increase N concentrations in the needles at the Hửglwald to a signicant extent [19] At our site it could be shown that the ... DISCUSSION The concentrations of N, P, K, and Mg were generally higher in the current needles than in the older needles at the Hửglwald site The opposite was observed for Ca, Mn and Al, while the Fe ... trend The K concentrations at the Hửglwald site were mostly lower than at other spruce stands in Europe [29, 43] In some years the K concentrations at the Hửglwald site were classied as very...

Ngày tải lên: 07/08/2014, 16:20

9 286 0
Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps

Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps

... showed the lowest N concentrations at the least fertile Danish site (DK-1) and two Lithuanian sites At the Danish site the growth rate, was also probably affected (Tab I) although the other elements ... September 2000 in Denmark at the DK-2 site At the other Danish site (DK-1) leaves were sampled at the end of August 2001 Leaf samples were collected from the upper third of the crown Current year ... –2 SE-1 At these sites lime was growing with a 30% admixture of oak (Q robur L) Values in the table give the total wood volume on the site, for both species together “–” Indicates that there was...

Ngày tải lên: 08/08/2014, 01:22

10 443 0
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

... in the acetabulum cup The solution for this problem is to improve the femoral fixation of the spacer stem Alternatively to that and at stable femoral fixation, the spacer itself may dislocate ... elegant method that treats both the fracture and the infection (Figure 8) At the time of prosthesis reimplantation, the spacer head can be easily removed and the modular prosthesis parts (neck ... an unstable joint situation results, the outcome of the surgery is endangered or the mobilisation of the patient is hereby limited Generally, the surgical treatment of these fractures should...

Ngày tải lên: 26/10/2012, 09:53

6 455 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx

Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx

... including transcription attenuation at the putative hairpin structure of precursor RNA (at the 5¢ end of the tRNALeu gene) have been proposed for the partial termination at the end of the rRNA genes [32,33] ... ending at nucleotide 16 295 of the genome ([20] see Fig 1) Since the RNA is polyadenylated, it is uncertain if the termination occurs at the C residue at 16 293 or the A residue at 16 295 of the ... to the upstream D-TERM site Transcription termination at the second CAA site, indicates the importance of this sequence motif in addition to AAUAAA sequence, in the termination process Quantitation...

Ngày tải lên: 08/03/2014, 08:20

13 415 0
Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot

Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot

... of the cytosine, which leads to the formation of a covalent bond between the enzyme and the substrate base The formation of the cysteine–cytosine bond increases the negative charge density at the ... substrate abolished the tritium incorporation into the MTase but at the same time the DNA got efficiently methylated This result illustrates that after binding both substrates (DNA and AdoMet) the ... Dnmt3a colored by atom type The distance between the sulfhydryl atom of the catalytic cysteine side chain and sulfur ˚ atom of AdoHcy (7.66 A) is indicated On the other hand, they harbor a cysteine...

Ngày tải lên: 14/03/2014, 23:20

9 437 0
The World’s Worst Pollution Problems: Assessing Health Risks at Hazardous Waste Sites pptx

The World’s Worst Pollution Problems: Assessing Health Risks at Hazardous Waste Sites pptx

... population pyramids were applied to individual sites The population and DALY estimates in this report are intended to be indicative rather than conclusive The Pollutants The generation of the ... are the major pollutants at these sites At the legacy pollution sites, radioactive waste was often disposed of directly into surrounding waterways, with no treatment or processing At other sites, ... advisory board, there is now primary data from extensive site assessments that can be used for estimating broad impacts These estimates are extrapolations based on estimated at risk populations, limited...

Ngày tải lên: 15/03/2014, 16:20

52 386 0
Báo cáo khoa học: Low U1 snRNP dependence at the NF1 exon 29 donor splice site doc

Báo cáo khoa học: Low U1 snRNP dependence at the NF1 exon 29 donor splice site doc

... New site New site New site New site New site New site New site Site broken Site broken New site New site New site New site New site Site broken New site Site broken New site Site broken Site ... New site Site broken New site New site Site broken Site broken Site broken Site broken Site broken Site broken New site Site broken New site New site New site Site broken Site broken New site Site ... sequence, using the following oligonucleotides: NF29-F, 5¢-ttcattcatatgaccatttgaatatacaatggt-3¢; and NF29-R, 5¢-aagtaacatatgatggagaaaggacatatat-3¢ Both oligonucleotides carry an Nde1 site in their 5¢-ends,...

Ngày tải lên: 16/03/2014, 01:20

14 206 0
Báo cáo khoa học: Roles of adenine anchoring and ion pairing at the coenzyme B12-binding site in diol dehydratase catalysis pptx

Báo cáo khoa học: Roles of adenine anchoring and ion pairing at the coenzyme B12-binding site in diol dehydratase catalysis pptx

... Lysb135 mutant diol dehydratases Table indicates that kcat values of the Kb135R, Kb135A and Kb135Q mutants were 58–76% that of the wild-type enzyme at saturating concentrations of FEBS Journal 275 ... incubation with the Sa224A mutant for 30 in the presence of substrate In contrast, the spectral change of AdoCbl upon incubation with the Sa224N apoenzyme was rather small even at 30 of incubation ... incubation with substrate at °C for (Fig 5B) This indicates that the steady-state concentration of an organic radical intermediate is very low with the Sa224A mutant, which is consistent with the...

Ngày tải lên: 23/03/2014, 06:20

13 380 0
w