... H, Tsukamoto T & Tatematsu M (1998) Expression of sucrase and intestinal-type alkaline phosphatase in colorectal carcinomas in rats treated with methylazoxymethanol acetate J Cancer Res Clin Oncol ... primer (5¢-aaatgtcttgaccagccgtc-3¢) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3¢); Chip3up primer (5¢-gctttgcagtcagaatggtc-3¢) and Chip3dw primer (5¢-ctgagcactgactacgaaac-3¢) The Chip1up and Chip1dw ... preparation and hybridization to murine MG_U74Av2 GeneChips (Affymetrix, Santa Clara, CA, USA), followed by microarray analysis as described elsewhere [51] Microarray Analysis Suite 5.0 (MAS, Affymetrix)...
Ngày tải lên: 29/03/2014, 21:20
... inducing factor ANOVA Analysis of variance ANT Adenine nucleotide transferase AP1 Activator protein ATP Adenosine triphosphate BrdU Bromodeoxyuridine CARD Caspase recruitment domains CAV3 Caveolin ... (targeted in inflammatory disease) (Gronemeyer et al., 2004) RXR agonists like 9-cis-retinoic acid (Panretin) and a synthetic analog (Targetin) are now approved by the Food and Drug Administration ... of AIF and inhibits its apoptogenic effects (Ravagnan et al., 2001) AIF lacks intrinsic nuclease activity and requires a binding partner to induce DNA cleavage and and AIF can cause overactivation...
Ngày tải lên: 14/09/2015, 14:04
Báo cáo y học: " Roles of XB130, a novel adaptor protein, in cancer" pps
... Foundation and International Society of Heart and Lung Transplantation (AS) Lists of abbreviations AFAP: actin filament associated protein; AFAP1L2: actin filament associated protein 1-like 2; PH domain: ... contains a coiled-coil domain A common feature of XB130 (818aa) and AFAP (730aa) is the presence of potential SH2, SH3-binding sites and two PH domains A coiled-coil domain of XB130 shares partial ... behavior XB130 interacts with binding partners and regulates cell cycle, survival, migration and invasion of cancer through tyrosine kinase-mediated signaling Shiozaki and Liu Journal of Clinical...
Ngày tải lên: 10/08/2014, 09:22
Signaling pathway inhibitor library screening reveals b catenin TCF4 as a novel telomerase regulator in cancer cell lines
... its near-absence in most normal tissues make telomerase an attractive therapeutic target However mechanism of telomerase activation in cancer has yet been documented in detail and insight into ... (ATM) and ATM and Rad3-related (ATR) protein kinases though detail mechanism has yet being elucidated (d'Adda di Fagagna et al 2003; Takai et al 2003) Telomeres can lose this protection via inhibition ... done in fission yeast Crb2, showing that during DNA damage ATM 53BP1 interact with H3K79me2 of histone H3 leading to the activation of DNA damage surveillance and DNA repair pathways (Huyen et al...
Ngày tải lên: 02/10/2015, 17:14
Báo cáo khoa học: Chinese hamster apurinic⁄apyrimidinic endonuclease (chAPE1) expressed in sf9 cells reveals that its endonuclease activity is regulated by phosphorylation docx
... phosphorylated chAPE1, whereas lambda phosphatase increased the catalytic activity of chAPE1 These data imply that CK I and CK II target different amino acids in chAPE1 and lambda phosphatase may work ... S, Hatsushika M, Tsutsui K, Akiyama K & Zhang B (1991) A mouse DNA repair enzyme (APEX nuclease) having exonuclease and apurinic ⁄ apyrimidinic endonuclease activities: purification and characterization ... Strauss PR, Beard WA, Patterson TA & Wilson SH (1997) Substrate binding by human apurinic ⁄ apyrimidinic endonuclease indicates a Briggs-Haldane mechanism J Biol Chem 272, 1302–1307 Lucas JA, Masuda...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... 5¢-CA CGCAGCTCATTGTAGAAGG-3¢ Another primer pair used for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCC ACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAA TACATCA-3¢ Western blot assay The cells were homogenized in ... primers harboring the mutations, 5¢-CTAATCTCTT CCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/ -182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCT CGTGATCTGCCCA-3¢ ... pair for SerpinA3 was ACT5-ACT3: 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... unleashing NMDA and AMPA excitotoxic injury Thus a mechanism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against spinal ... complex was precipitated with 100 µl of goat anti rabbit IgG and 10 µl of normal rabbit serum (Peninsula Laboratories Inc., San Carlos, CA) dissolved in RIA buffer After incubating at room temperature ... hypothesis was rejected at the 0.05 level in all analyses Statistical analysis Results Statistical analyses were performed using SigmaStat (version 3.0, SPSS Inc., Chicago, IL) Independently measured...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... for caspases and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, and Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC ... substrate (bar A) for each was as follows: caspase 1, WEHD-AMC; caspase 2, VDVADAMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; caspase ... currently uncharacterized gene Interestingly, a distant relative of the caspases, termed paracaspase, was identified in Homo sapiens using a PSI-BLAST search [39] Paracaspase could be a candidate gene...
Ngày tải lên: 19/02/2014, 13:20
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... Mammalian GLD–2 homologs are poly (A) polymerases Proc Natl Acad Sci USA 101, 4407–4412 Nakanishi T, Kubota H, Ishibashi N, Kumagai S, Watanabe H, Yamashita M, Kashiwabara S, Miyado K & Baba T (2006) ... may mediate the enhancing effect of splicing on mRNA translation [34–36] Rbm9, as a splicing factor interacting with a PAP, may also participate in the translational enhancement mediated by introns ... The active form of Xp54 RNA helicase in translational repression is an RNA-mediated oligomer Nucleic Acids Res 32, 1325– 1334 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp351-SUT2 was linearized ... 5¢-GTTTAGAA TTCGATTGTAGGCAGAA-3¢ and Flo11_lacZ_rev 5¢-AGGATCCAAATAAGCGAGTAGAAAT-3¢, respectively Plasmid pYLZ-6 was converted to an integration plasmid, as suggested [15], and the amplified FLO11fragment...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... mutations into each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢ ... believed to interact indirectly with the actin cytoskeleton via intermediary proteins, such as zyxin and a- actinin, recent studies have shown that CRP1 and CRP2 are autonomous actin-binding proteins...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... were as follows: sense primer, 5¢-CGATCCAAGCTTTAAGGAGG AAtagGAAATGGAATTCATCGAAAAAATCCG-3¢ antisense primer, 5¢-TGCATCCATCTAGAGCATTCA GC-3¢ The amplified PCR product was digested with HindIII and ... T., Sasamoto, S., Watanabe, A. , Idesawa, K., Ishikawa, A. , Kawashima, K., Kimura, T., Kishida, Y., Kiyokawa, C., Kohara, M., Matsumoto, M., Matsuno, A. , Mochizuki, Y., Nakayama, S., Nakazaki, ... L-Prolinamide L-Phenylalaninamide L-Methioninamide L-Phenylglycinamide L-Alaninamide No L-Amino amidase L-Prolinamide L-Valinamide L -a- Methylvalinamide No primary sequences of the three amidases have...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx
... prodomain (40 amino acids); and (c) a mature peptide (21 amino acids) (Fig 3) A canonical polyadenylation signal was found in the 3¢ UTR White bass hepcidin genomic DNA sequence and gene organization ... but increases to extremely high levels following bacterial challenge This is in contrast to another AMP, moronecidin, found in the bass gill and skin that was analyzed in these same fish and found ... hepcidin, a homologue of human hepcidin, was isolated from the gills, demonstrates antibacterial activity against E coli, and was dramatically induced in the liver following the challenge with fish pathogen,...
Ngày tải lên: 24/03/2014, 03:21
microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice
... cortex and hippocampus, and the injection of A (1-42) in the nucleus basalis reduced ChAT in the cortex (Nabeshima and Nitta, 1994; Yamaguchi and Kawashima, 2001; Harkany et al., 1999), and enhanced ... corticocortical projection field patterns to determine the cortical laminar distribution of A plaques in AD It is reasonable to speculate that the mEH activation around some plaques is at least partially ... wide at the bottom and 10 cm wide at the top The arms converged at an equilateral triangular central area that was cm at its longest axis Each mouse was placed at the end of one arm and allowed...
Ngày tải lên: 12/06/2014, 15:50
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... manuscript SL and TS evaluated and interpreted SNP microarray and aCGH data All authors read and approved the final manuscript for publication Acknowledgments We thank the heterotaxy patients and families...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... mutants deleted in a Zn Finger domain (ΔZn) or in an acidic domain (ΔAD) Neither mutant could bind Vif, whereas the mutant containing amino acids 168–411 was able to bind Vif, suggesting that ... factor [3], which belongs to the APOBEC superfamily of cytidine deaminases, consisting of APOBEC1, APOBEC2, AID (activation-induced cytidine deaminase), APOBEC3 (A- H), and APOBEC4 [4] A3 G is incorporated ... ubiquitination, we tried to identify a novel E3 ligase that may be involved in the ubiquitination of Vif During a search for Vif-interacting proteins in the HIV, Human Protein Interaction Database...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " In-Silico docking of HIV-1 integrase inhibitors reveals a novel drug type acting on an enzyme/DNA reaction intermediate" pdf
... IXa and Xa Bioorg Med Chem Lett 2004, 21:5263-5267 Sato M, Motomura T, Aramaki H, Matsuda T, Yamashita M, Ito Y, Kawakami H, Matsuzaki Y, Watanabe W, Yamataka K, Ikeda S, Kodama E, Matsuoka M, ... (involved in the gene-silencing pathway) [1,6] These proteins display similar 3D folding of the catalytic domain and a conserved catalytic triad of metal-coordinating carboxylates IN catalyses at least ... to as target DNA or acceptor DNA) Strand transfer leaves a five-base, single-stranded gap at each junction between the integrated proviral DNA and the host acceptor DNA, and a (usually) two-base...
Ngày tải lên: 13/08/2014, 09:20
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
... agents including chemotherapeutic agents Removal of the damaged base by a DNA glycosylase creates an apurinic / apyrimidinic (AP) site AP endonuclease1 (Ape1), a critical component in this pathway, ... radiation therapy are the mainstream treatment options available to treat cancers Many chemotherapeutic drugs act by damaging DNA, which leads to an accumulation of damage resulting in impaired ... in India, for being so encouraging and for always believing in me To my parents -in- law, Capt Prafull Bhate and Dr Jyotsna Bhate and my brother and sister -in- law, Anmol and Rama Bhate: thank you...
Ngày tải lên: 24/08/2014, 13:10
Endofin is a novel component in EGR EGFR oncogenic signaling
... as actin-driven macropinocytosis and phagocytosis, dynamin-dependent caveolin-1 associated caveolar endocytosis, a CIE pathway that involves CDC42, ADP-ribosylation factor (ARF1), actin and another ... glycosylated, extracellular N-terminal region (621 amino acids), a transmembrane segment (amino acids 622-644), followed by an intracellular domain that contains a juxtamembrane region, a tyrosine kinase ... by APPL and this in turn may affect the intensity of MAPK signaling 1.8 FYVE domain-containing proteins A group of proteins that are also implicated in EGFR trafficking and signaling are the...
Ngày tải lên: 11/09/2015, 10:00
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc
... 5¢-CATGGACATAAGTCCTTTTCCCTTCCTCCT-3¢, and 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG TAT-3¢ The full-length mouse cDNA was obtained with primers 4x1-f-pF, 5¢-ATGGAGGCCTCCTGGCTGGAG ACTCGTTGG-3¢ and 4x1-f-pR, 5¢-AAACATAAATTT CGCCATTTCTCCTAGTAT-3¢ ... protein was used to raise antisera in rabbit, which were able to detect ng of the antigen (data not shown) As shown in Fig 5B, antisera detected a principal protein band of 55 kDa in brain ... mid-way along the chain Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant...
Ngày tải lên: 19/02/2014, 07:20