angiogenesis—mediators of notch signaling in gliomas

Báo cáo sinh học: "Compound developmental eye disorders following inactivation of TGF signaling in neural-crest stem cells" doc

Báo cáo sinh học: "Compound developmental eye disorders following inactivation of TGF signaling in neural-crest stem cells" doc

... cultured in DMEM:F12 medium (Gibco/Invitrogen, Carlsbad, USA) containing 10% fetal bovine serum (Sigma) Following a 60 incubation in DMEM:F12 medium containing 0.1% bovine serum albumin at 37°C, ... anomalies in Tgfbr2-mutant mice (a) Toluidine blue staining of semi-thin sagittal sections of eyes at E18 reveals a smaller size with no anterior chamber and an infiltration of cells behind the lens in ... images (insets) visualizing the pigment of the forming iris (broken line in the main image) reveal initiation of ciliarybody formation (white arrowheads) in control eyes and its absence in Tgfbr2-mutant...

Ngày tải lên: 06/08/2014, 18:21

16 303 0
Báo cáo y học: " Involvement of mTOR signaling in sphingosylphosphorylcholine-induced hypopigmentation effects" pps

Báo cáo y học: " Involvement of mTOR signaling in sphingosylphosphorylcholine-induced hypopigmentation effects" pps

... activation of the serine/threonine mTOR protein kinase is involved in the inhibition of melanin synthesis in B16 melanoma cells [30] Because SPC triggers the activation of Akt, we Jeong et al Journal of ... quantifying the protein levels of the lysate and adjusting the protein concentrations with lysis buffer, 90 μL of each lysate containing the same amount of protein was placed in each well of a 96-well ... cells were incubated with SPC in the presence or absence of rapamycin, a specific mTOR inhibitor Addition of rapamycin significantly abolished the inhibition of melanin synthesis in SPC-treated...

Ngày tải lên: 10/08/2014, 10:20

8 320 0
Báo cáo y học: " Vascular alterations upon activation of TGFβ signaling in fibroblasts - implications for systemic sclerosis" potx

Báo cáo y học: " Vascular alterations upon activation of TGFβ signaling in fibroblasts - implications for systemic sclerosis" potx

... JM, Behringer RR, de Crombrugghe B: Postnatal induction of transforming growth factor beta signaling in fibroblasts of mice recapitulates clinical, histologic, and biochemical features of scleroderma ... observed in human SSc more closely? The demonstration Page of of typical SSc-like changes in these vessels would further strengthen the importance of TGFβ signaling in the vascular pathology of SSc ... expression of the kinase-deficient TβRIIΔk construct in fibroblasts activates TGFβ signaling in other cell types such as vSMCs are poorly understood Thus, confirmation of the altered phenotype of vSMCs in...

Ngày tải lên: 12/08/2014, 14:21

2 201 0
Báo cáo y học: "EM703 improves bleomycin-induced pulmonary fibrosis in mice by the inhibition of TGF-β signaling in lung fibroblasts" doc

Báo cáo y học: "EM703 improves bleomycin-induced pulmonary fibrosis in mice by the inhibition of TGF-β signaling in lung fibroblasts" doc

... effects of EM703 on the inflammatory phase, we investigated bleomycin-induced changes in the cell populations in BAL fluid on day after bleomycin injection The increase in the number of macrophages ... by EM703 (Figure 6) The mechanisms of inhibition by EM703 of bleomycininduced pulmonary fibrosis in mice may involve the inhibition of TGF-β signaling, mediating fibroblast proliferation and extracellular ... anti-fibrotic effects of EM703 in the attenuation of bleomycin-induced pulmonary fibrosis Although there is a room for further investigation of the mechanism of EM703 inhibition of bleomycin-induced lung...

Ngày tải lên: 12/08/2014, 16:20

13 324 0
Jagged notch signaling in zebrafish pronephros development

Jagged notch signaling in zebrafish pronephros development

... Hong et al., 2006) 1.4 Notch Signaling: Regulation of Notch Signaling and Function in Kidney 1.4.1 Notch Signaling: Lateral Inhibition and Lateral Induction Notch signaling is an evolutionarily ... and the inner ear, and that of Delta -Notch signaling in neural tissue, the inner ear and the intestine In all these cases, the blockage of Notch signaling leads to a failure in lateral inhibition ... process, since it interacts with Jagged2a and facilitates Jagged2a internalization In summary, our findings indicate a new function of Notch signaling in cell differentiation within a zebrafish...

Ngày tải lên: 14/09/2015, 10:29

117 144 0
Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx

Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx

... secretion of Notch [16] In ofut1 mutant cells, the Notch protein accumulates in intracellular compartments marked by ER markers, and knockdown of Ofut1 using doublestranded RNA in cultured cells inhibits ... localization of Notch in ofut1 mutant cells using a detergent-free cell-surface staining protocol A striking difference in surface staining was observed between wildtype and ofut1 mutant cells This convincingly ... Figure 1c) in which Ofut1 regulates the endocytic trafficking of Notch at a post-internalization step so that Notch accumulates in an undefined endocytic compartment in the absence of ofut1 activity...

Ngày tải lên: 06/08/2014, 18:21

5 419 0
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

... Thus, integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... Osmosensing and signaling in mammalian cell function F Schliess et al [7] On the other hand, hyperosmotic shrinkage prevents insulin-induced hepatocyte swelling and proteolysis inhibition, indicating ... R, vom Dahl S & Haussinger D (2004) Involvement of integrins and Src ¨ in insulin signaling towards autophagic proteolysis in rat liver J Biol Chem 279, 21294–21301 15 Reinehr R, Becker S, Braun...

Ngày tải lên: 18/02/2014, 16:20

5 792 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

... work investigating the interaction of P2Y12 with P2Y1 signaling [25,40] We find that P2Y12 enhances the thrombin-induced Ca2+ response in a way not only involving adenylyl cyclase ⁄ PKA inhibition, ... ADP increased the thrombininduced Ca2+ integral by 93 ± 16% or 76 ± 10% in the presence of EGTA or CaCl2, respectively (Fig 3) Fig P2Y12 enhances thrombin-induced Ca2+ responses independent of ... [26], we determined how P2Y12 signaling affects InsP3induced mobilization of Ca2+ from intracellular stores Using saponin-permeabilized platelets, the Ca2+ release was measured in response to...

Ngày tải lên: 18/02/2014, 16:20

15 565 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

... products were mixed in the following combinations: 18SVH–linker and linker) 18VL, 18VH–linker and linker)18VL, 21SVH–linker and linker)21VL, 21VH–linker and linker)21VL and singlechain antibodies, ... coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG GACCTGTAG-3¢) and noncoding linker containing an EcoRI site at the 5¢ end of the linker ... Crea R & Oppermann H (1988) Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli Proc Natl Acad...

Ngày tải lên: 16/03/2014, 14:20

14 493 0
Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

... agent vincristine, combination vincristine plus rapamycin, single agent sunitinib, combination sunitinib plus rapamycin, single agent bevacizumab, and combination bevacizumab plus rapamycin As ... rapamycin treated, asparaginase treated, asparaginase plus rapamycin combination treated, vincristine treated, vincristine plus rapamycin combination treated, sunitinib treated, sunitinib plus ... favored, and mTOR kinase is constitutively activated causing hyperphosphorylation of the downstream effectors (p70 S6 kinase and 4E-binding protein1) resulting in increased protein translation,...

Ngày tải lên: 18/06/2014, 16:20

18 612 0
Báo cáo hóa học: "Involvement of aryl hydrocarbon receptor signaling in the development of small cell lung cancer induced by HPV E6/E7 oncoproteins" ppt

Báo cáo hóa học: "Involvement of aryl hydrocarbon receptor signaling in the development of small cell lung cancer induced by HPV E6/E7 oncoproteins" ppt

... Therefore, an increase in knowledge of factors promoting lung carcinogenesis, as the infection with human papillomavirus, gains in importance In this study we examined the gene expression profile of previously ... from in situ to invasive carcinoma and in a minor percentage brain, liver and pancreas metastases were observed Inactivation of p53 and pRB occurs in the majority of neuroendocrine lung carcinomas ... subsequently leading to progression of the cell into the S-phase [14] Furthermore, E7 binds to inhibitors of cyclin-dependent kinases (p16, p21), increasing the level of phosphorylated pRb In this way,...

Ngày tải lên: 18/06/2014, 16:20

11 471 0
báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

báo cáo hóa học: " A randomized trial of a lifestyle intervention in obese endometrial cancer survivors: quality of life outcomes and mediators of behavior change" pptx

... improved in patients who lost weight Weight losers, however had a lower disinhibition score, indicating an increase likelihood to overeat in the presence of disinhibitors This was an unexpected finding ... also examined according to whether patients lost weight or their weight remained stable/ gained over the course of the year as an ancillary stratified analyses We were interested in examining if ... discomfort in those women who lost weight during the year In addition, self-efficacy scores at twelve months remained increased, six months after the intervention had concluded In terms of eating behavior,...

Ngày tải lên: 18/06/2014, 19:20

9 444 0
Báo cáo sinh học: " The involvement of survival signaling pathways in rubella-virus induced apoptosis" ppt

Báo cáo sinh học: " The involvement of survival signaling pathways in rubella-virus induced apoptosis" ppt

... magnitude of RV-induced apoptosis To evaluate the role of PI3K-dependent signaling during RV infection, the effects of PI3K inhibitor LY294002 on the development of RV-induced apoptosis were examined, ... Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation Biochem ... 37°C in 5% CO2 in air Cells were treated, in a final volume of 100 µl, with RV and kinase inhibitors as described above At indicated times p.i., 50 µl of labeling mixture containing XTT (sodium...

Ngày tải lên: 18/06/2014, 22:20

12 357 0
Báo cáo hóa học: " An FIR Notch Filter for Adaptive Filtering of a Sinusoid in Correlated Noise" potx

Báo cáo hóa học: " An FIR Notch Filter for Adaptive Filtering of a Sinusoid in Correlated Noise" potx

... May 2003 [9] A Hocanin and O Kukrer, “Estimation of the frequency and waveform of a single-tone sinusoid using an offline-optimized adaptive filter,” in Proceedings of IEEE International Conference ... method of Lagrange multipliers Incorporating the constraint (4) in the cost function, we obtain J2 = hT Cho + λT Aho −p , o (8) where λ = [λ1 λ2 ]T is the vector of Lagrange multipliers The minimization ... term in (18), which has constant coefficients of the powers of z Now, He (z, α) can be written in the form of He,o (z) in (17) as N −1 He (z, α) = − hn (α)z−(n+1) and solving for Δθs , the updating...

Ngày tải lên: 22/06/2014, 23:20

10 452 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

... with insulin for binding to the insulin receptor (InR) and inhibit the autophosphorylation of InR [6] Furthermore, IGFBP-7 is suspected to be a tumor suppressor in a variety of human organs, including ... IGFBPs, possibly accounting for the affinity of IGFBP-7 for insulin [6] Interestingly, Imp-L2 has been shown to bind human insulin, IGF-I, IGF-II and proinsulin, and its homolog in the moth Spodoptera ... levels in vivo [24] The amount of membrane-bound tGPH reflects signaling activity in the phosphoinositide 3-kinase/protein kinase B (PI 3-kinase/ PKB) pathway Overexpression of dInR resulted in a...

Ngày tải lên: 06/08/2014, 18:21

11 345 0
Báo cáo sinh học : " Notch signaling, the segmentation clock, and the patterning of vertebrate somites" pptx

Báo cáo sinh học : " Notch signaling, the segmentation clock, and the patterning of vertebrate somites" pptx

... Drosophila wing disc, Notch signaling plays a critical part in organizing the dorso-ventral compartment boundary [41]; and in the vertebrate hindbrain, likewise, it is involved in organizing the ... function of Notch signaling in many different systems [1] Notch signaling is dispensible for boundary formation in zebrafish It is in the anterior part of the PSM, where the oscillation of cyclic ... only function of Notch signaling is to maintain synchrony in the posterior PSM [29] Cleft formation correlates with the appearance of sharp boundaries of gene expression Findings in the mouse,...

Ngày tải lên: 06/08/2014, 19:20

7 315 0
Báo cáo y học: "Resistance to IL-10 inhibition of interferon gamma production and expression of suppressor of cytokine signaling 1 in CD4+ T cells from patients with rheumatoid arthritis" ppsx

Báo cáo y học: "Resistance to IL-10 inhibition of interferon gamma production and expression of suppressor of cytokine signaling 1 in CD4+ T cells from patients with rheumatoid arthritis" ppsx

... Yamana et al of endogenous JAK kinase inhibitors that can act in classic feedback inhibition loops, but their roles as the mediators of crosstalk inhibition by opposing cytokine signaling pathways ... levels of SOCS1 and SOCS3 mRNA, respectively [44] IL-12-induced STAT4 activation is inhibited by SOCS3 induction in Th2 cells, whereas IL4-induced STAT6 signaling is diminished by SOCS1 induction in ... role in both the induction of STAT3 activation and the resistance to the inhibitory effect of IL-10 in RA CD4+ T cells High expression of SOCS1 mRNA in RA CD4+ T cells IL-6 induces two potent inhibitors...

Ngày tải lên: 09/08/2014, 01:24

11 605 0
Báo cáo y học: "Transcriptional regulation of collagenase (MMP-1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factor" ppt

Báo cáo y học: "Transcriptional regulation of collagenase (MMP-1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factor" ppt

... Manning AM, Firestein GS: c-Jun N-terminal kinase is required for metalloproteinase expression and joint destruction in inflammatory arthritis J Clin Invest 2001, 108:73-81 Vincenti MP, Brinckerhoff ... DE: Pharmacological profile of SB 203580, a selective inhibitor of cytokine suppressive binding protein/p38 kinase, in animal models of arthritis, bone resorption, endotoxin shock and immune function ... (Fig 2) Upon binding of IL-1 to its cognate receptor, transforminggrowth-factor-β-activated kinase becomes active, leading to the activation of the NF-κB-inducing kinase (NIK) [26] In turn, NIK...

Ngày tải lên: 09/08/2014, 03:24

8 436 0
Báo cáo y học: "Reduced transforming growth factor-beta signaling in cartilage of old mice: role in impaired repair capacity" ppsx

Báo cáo y học: "Reduced transforming growth factor-beta signaling in cartilage of old mice: role in impaired repair capacity" ppsx

... growth factor (TGF)-beta signaling Staining ofin cartilage molecules in cartilage Paraffin sections of knee joints of young and old mice were stained with antibodies against (a,c) Smad2, (b,d) ... The intensity of the staining was not taken into account as no obvious differences were observed in staining intensities in the different experimental groups: young/old or -IL-1/+IL-1 The obtained ... reducing the counteractive abilities of TGF-beta to IL-1, we examined the effect of IL-1 injection on the expression of TGF-beta signaling components in the articular cartilage Injection of IL-1...

Ngày tải lên: 09/08/2014, 07:20

10 412 0
w