alignment a profile and an assembly

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

... to be at work A man I walked in Another man~ walked ont Hez was angry (15) A man walked in John saw the man Example (15) has a natural reading where the definite description is anaphorically linked ... metamodule Evaluation and an object program Logic Database, and the meta-program manipulates the object program We translate first order conditions into G6del goals, and then apply the goal to the ... to an antecedent We propose to make such implicit anaphoric links explicit, as in (16) In example (4) the noun phrase another man is anaphorically constrained by an antecedent noun phrase a man...

Ngày tải lên: 09/03/2014, 01:20

10 366 0
báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx

báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx

... copper amalgam? In what year did all your use of copper amalgam end* Have you worked with amalgam that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and ... the participants started and ended the use of copper amalgam and Dentomat was analyzed by calculating the mean difference from the absolute values of the difference between the pairs, standard ... in a mortar? If yes: In that case, when and for how many years? From year to year Have you mixed amalgam in a Dentomat? Yes-no Did you use a Dentomat (semi-automatic device) to prepare amalgam?...

Ngày tải lên: 20/06/2014, 00:20

8 422 0
Writing a Simple Program in an Assembly Language

Writing a Simple Program in an Assembly Language

... destination operand The results and answers to calculations are stored in the destination operand Note that some instructions have only one operand (destination operand) or none at all Sample ... R0L,R1L Bad sample (the same name as an internal register is used as a symbol) Samples available as symbols: Loop Upper and lower cases may be mixed "_" is available as a character End_of_Loop A numeric ... reserve an area for writing there: SECTION WORK,DATA,LOCATE=H'2000 DATA1: RES.B DATA2: RES.B ANSWER: RES.B In the above, DATA1, DATA2 and ANSWER represent the H'2000, H'2001 and H'2002 addresses...

Ngày tải lên: 29/09/2013, 11:20

24 534 0
Tài liệu Lab A: Creating and Configuring an Active Directory Management Agent pptx

Tài liệu Lab A: Creating and Configuring an Active Directory Management Agent pptx

... namespace and user entries have been created a In the directory pane, expand domain MA, expand domain.nwtraders.msft, and then verify that the nwtraders users organizational unit exists b Expand nwtraders ... Lab A: Creating and Configuring an Active Directory Management Agent Exercise Creating an Active Directory Management Agent In this exercise, you will create an Active Directory management agent ... Create a Management Agent Mode: Association In the Configure the Management Agent dialog box, on the Connected Directory Specifics tab, on the Mode and Namespace Management tab, under Management...

Ngày tải lên: 24/01/2014, 19:20

6 514 0
Tài liệu AUDIT COMMITTEES COMBINED CODE GUIDANCE: A report and proposed guidance by an FRC-appointed group chaired by Sir Robert Smith docx

Tài liệu AUDIT COMMITTEES COMBINED CODE GUIDANCE: A report and proposed guidance by an FRC-appointed group chaired by Sir Robert Smith docx

... of and developments in financial reporting and related company law In appropriate cases, it may also include, for example, understanding financial statements, applicable accounting standards and ... complete and accurate financial statements and disclosures in accordance with financial reporting standards and applicable rules and regulations However the audit committee should consider significant ... whom is financially literate and at least one of whom has accounting or financial management expertise Have a formal written charter and code of business conduct that has been adopted and approved...

Ngày tải lên: 18/02/2014, 04:20

52 307 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

... Konno et al However, it was reported that, in the aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins ... ⁄ Ala-Xaa-Asp ⁄ Glu-Xaa (Xaa stands for any amino acid) and NH and C@O of the main chain of the residue corresponding to Val418 in the S16 strand are directed inside In free E coli Met-tRNA synthetase ... the a- NH2 group of Arg and the main chain C@O of Ser127 and ˚ O of the side chain of Asn129 are set at 3.15 A and ˚ , and the distances between the guanidinium 3.04 A moiety and the side chain...

Ngày tải lên: 18/02/2014, 11:20

17 512 0
Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx

Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx

... R solanacearum and two mutant strains with mutations in the PPO genes RSc0337 and RSc1501 TH activity was determined at pH and 0.05% SDS, and DO activity at pH and 0.02% SDS genes, which was opposite ... tyrosinase gene Mepa J Bacteriol 175, 5403–5410 11 Lopez-Serrano D, Sanchez-Amat A & Solano F (2002) Cloning and molecular characterization of a SDSactivated tyrosinase from Marinomonas mediterranea ... A novel tyrosinase from Rastonia solanacearum ´ D Hernandez-Romero et al A B C particular catechol to o-dopaquinone is also called dopa oxidase (DO) activity On the other hand, laccases...

Ngày tải lên: 19/02/2014, 07:20

14 849 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit ... predicted transmembrane domain Analysis of complex I assembly and activity The first step in the analysis was to analyze mitochondria by SDS/PAGE Mitochondrial extracts from mutant cells (V79-G18), and...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... encode a bifunctional enzyme consisting of an RNase H domain and an APase domain The RNase H and APase activities of the full length SCO2299 protein depend on its N-terminal RNase H domain and C-terminal ... here is a bifunctional enzyme consisting of an RNase H domain and an APase domain, and it is a novel style in the Type RNase H family Experimental procedures Cells, plasmids, and materials The ... Mori and T Baba (Institute for Advanced Biosciences, Keio University, Yamagata, Japan) Details on these strains in ASKA (a complete set of E coli K-12 ORF archive) library are available at http://ecoli...

Ngày tải lên: 19/02/2014, 18:20

10 561 1
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin sera were gifts ... sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

... Acknowledgements We thank Montserrat Anguera, Jennifer Erwin and Janice Ahn for critical reading of the manuscript, and all members of Sakaguchi Laboratory for help and discussions S H N is a research fellow ... Biochem 269, 164–174 45 Nara T, Hamada F, Namekawa S & Sakaguchi K (2001) Strand exchange reaction in vitro and DNAdependent ATPase activity of recombinant LIM15/ DMC1 and RAD51 proteins from Coprinus ... Verreault A, Kaufman PD, Kobayashi R & Stillman B (1996) Nucleosome assembly by a complex of CAF-1 and acetylated histones H3/H4 Cell 87, 95–104 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Stillman...

Ngày tải lên: 07/03/2014, 05:20

10 487 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

... AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 16864 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR products were resolved on a 1.5% (w/v) agarose...

Ngày tải lên: 08/03/2014, 08:20

12 507 0
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

... Regional organizations and institutions can help facilitate cooperation and coordination and international financial institutions and donors can then play a vital role in seeding and facilitating ... in particular countries in sub-Saharan Africa, as well as in the Caribbean and Pacific islands, Central America or Caucasus and Central Asian countries The transaction costs for international ... internationally 45 The members of the DAC are: Australia, Austria, Belgium, Canada, Denmark, Finland, France, Germany, Greece, Italy, Ireland, Japan, Luxembourg, the Netherlands, New Zealand, Norway,...

Ngày tải lên: 15/03/2014, 19:20

125 1,3K 0
Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot

Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot

... RP-HPLC analysis of reaction mixtures containing L-AMP, LUC, CoA and CoA analogues Reaction mixtures containing L-AMP (20 lM), LUC, and CoA or the indicated CoA analogues were incubated for 10 After ... of 20 and 100 lm, respectively) into assay tubes that contained Hepes pH 8.2, MgCl2 and LUC (60 nm) and after 30 s, and 10 of incubation, aliquots were withdraw and analysed as described above ... intensity was attained (12 s) the formation of the inhibitory product antagonized by CoA has only began and the effect of CoA at that assay time was nil or a discrete activation (always less than 20%)...

Ngày tải lên: 16/03/2014, 23:20

11 475 0
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

... essentially the same in both cases and, above all, no appreciable differences in the rates of disappearance of ATP or appearance of Ino were observed Theoretical approach mathematical simulation ... cells and automated assays of adenylate, citrate, pyruvate and glucose-6-phosphate pools Anal Biochem 58, 208216 23 Sillero, M .A. , Del Valle, M., Zaera, E., Michelena, P., Garcia, A. G & Sillero, A ... yeast with H2O2 and menadione Here, mitochondrial proteins (E2 subunits of both pyruvate kinase and a- ketoglutarate dehydrogenase, aconitase and heat shock protein 60) and the cytosolic fatty acid...

Ngày tải lên: 17/03/2014, 10:20

12 506 0
Báo cáo khoa học: Apo a-lactalbumin and lysozyme are colocalized in their subsequently formed spherical supramolecular assembly doc

Báo cáo khoa học: Apo a-lactalbumin and lysozyme are colocalized in their subsequently formed spherical supramolecular assembly doc

... microscopy and CSLM are compared This comparison was B Fig Confocal scanning laser micrographs of microspheres prepared from apo a- LAFITC and unlabelled LYS (A) or unlabelled apo a- LA and LYS-RBITC ... (gray) and LYSRBITC ⁄ apo a- LA-FITC (black) excited at 543 nm (A) , and LYS ⁄ apo a- LA-FITC (gray) and LYS-RBITC ⁄ apo a- LA-FITC (black) excited at 488 nm (B) in an emission spectrum containing ... spherical particles between calcium-depleted a- lactalbumin (apo a- LA) and chemically unmodified hen egg-white lysozyme (LYS) [3] LYS and a- lactalbumin are two related proteins of 129 and 123 amino acid...

Ngày tải lên: 23/03/2014, 07:20

9 300 0
Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc

Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc

... NI and RNI distributions remains essentially the same as above However, the mean NI and RNI are now roughly 50% lower than in the base case (see Table A4 and Table 1) A bank earns a substantial ... piergiorgio.alessandri@bankofengland.co.uk Corresponding author: Bank for International Settlements, Centralbahnplatz 2, CH-4002 Basel, Switzerland; e-mail: mathias.drehmann@bis.org © European Central Bank, ... is a non-separable function of market and credit risk factors The author compares an integrated capital measure to additive measures calculated under a range of credit and market risk models, and...

Ngày tải lên: 29/03/2014, 13:20

57 1,2K 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... characterized by minima at 207 nm and by a maximum at 190 nm The negative band at 207 nm had a lower intensity in the case of rBmKIM in comparison with that in the spectra of AaHIT2 (a- toxin) and ... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... by small residues such as A (Ala) or D (Asp) Only AaHIT4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
w