account with a debit to account 659

Tài liệu SPANISH GENERAL ACCOUNTING PLAN pptx

Tài liệu SPANISH GENERAL ACCOUNTING PLAN pptx

... measurement standards or standards for the preparation of annual accounts 26 PART ONE ACCOUNTING FRAMEWORK 1) Annual accounts Fair presentation A company’s annual accounts comprise the balance sheet, ... the annual accounts 123 ABREVIATED FORMAT FOR ANNUAL ACCOUNTS 161 6.1 Abbreviated format for annual accounts 161 6.2 Content of the notes to the abbreviated annual accounts 167 CHART OF ACCOUNTS ... International Accounting Standards (hereinafter adopted IAS/IFRS) The Regulation made it mandatory to apply these standards in the preparation of consolidated annual accounts by listed companies,...

Ngày tải lên: 18/02/2014, 01:20

366 498 0
Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... nucleotides and analogues to ABCG2R482G (A) Purified ABCG2R482G (0.25 lg) was photolabelled with [a3 2P]azido-ATP (3–300 lM) as described in Materials and methods Labelled protein was visualized and quantified ... Callaghan R (2008) Resistance to chemotherapy in cancer: a complex and integrated cellular response Pharmacology 81, 275–300 Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I & Gottesman ... a stable post-hydrolysis conformation, we employed the vanadate trapping procedure The data revealed that vanadate-trapped ABCG2R482G protein ([E]Æ[ADP]Æ[Vi]) remained in a low-affinity [3H]daunomycin...

Ngày tải lên: 18/02/2014, 18:20

9 564 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx

BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx

... representatives and experts in brand valuation, with Jan Treffner as chairman “It’s beneficial to have a common standard that can be compared, especially when awareness about the importance of brands and ... the book Varumärket som värdeskapare (Brand as a Creator of Value) Half of Coca-Cola’s market value today is tied to the brand The value of the Swedish apparel giant H&M’s brand is set at USD 11 ... director for bath and washroom solutions at SCA “The primary functions are to have good cleaning and to have the toilet paper work as a barrier for the hand you wipe with, ” she says “The paper also...

Ngày tải lên: 09/03/2014, 00:20

36 485 0
MEALS ARE FREE UNLESS OTHERWISE NOTED: For additional listings provided by the Meals Partnership Coalition pot

MEALS ARE FREE UNLESS OTHERWISE NOTED: For additional listings provided by the Meals Partnership Coalition pot

... OUTREACH BREAKFAST 400 East Pike Street Seattle 206-322-7411 Breakfast: 2nd and 4th Saturdays Open to all PACIFIC ASIAN EMPOWERMENT PROGRAM 270 So Hanford St., Suite 204 Seattle, WA 98134 Contact: ... (Bush-Asia Center (downstairs/park level)) 409 Maynard Ave So Seattle, WA 98104 Contact: Frank Bacungan Phone: 206-292.5184 Lunch: Monday-Friday (11:00 AM – 1:00 PM) serving Asian meals Criteria: ... Wednesdays and Fridays (10:30AM – 1:00PM) Hmong Senior Club Group 5740 Martin Luther King Jr Way Seattle, WA 98118 Lunch: Wednesdays and Fridays (10:30AM – 1:00PM) Samoan American Pacific Organization...

Ngày tải lên: 22/03/2014, 21:20

15 358 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... 41 to 49 are close to the peptide center of mass and are attracted by contact with the polar backbone, lipid residues 50–60 make van der Waals contacts with the amino acid side chains of Ab, and ... rat synaptic plasma membranes has shown that monomeric Ab can intercalate into the bilayer interior and lead to decreased bilayer thickness [7] The same study also concluded that Ab40 increased ... study by Mason et al [7] indicated that Ab40 was capable of penetrating into rat synaptic plasma membranes, thus decreasing bilayer thickness In addition, Kayed et al [11] report that, although...

Ngày tải lên: 18/02/2014, 08:20

16 475 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... helper phage (Stratagene) One microgram was utilized in mutagenesis reactions together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ... primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried out using Amplitaq enzyme according to the manufacturer’s instructions ... d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s instructions (mutagenic nucleotide are underlined) Mutated plasmids were designated...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

... chemiluminescence (Amersham ⁄ GE Healthcare Ltd, Chalfont St Giles, UK), and the signal was quantified on a Kodak Image Station 440CF and analyzed with Kodak 1d image software Monoclonal antibodies against ... 30 in galactose medium to activate the GAL regulon Total mRNAs were extracted and subjected to standard northern blot analysis GAL1 mRNA, and ACT1 mRNA (considered as a loading control), were detected ... protein kinases, autophosphorylation of Bud32p on its activation loop correlated with an increased activity on substrates, whereas all the mutant forms unable to autophosphorylate were also inactive...

Ngày tải lên: 07/03/2014, 04:20

15 414 0
For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx

For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx

... did tons of research and data gathering about men that no one had done before Turns out, her Harvard graduate degree and years as a Wall Street analyst helped pave the way for these well-researched ... TV and radio, and Shaunti has had speaking engagements about it all across the country People started asking Shaunti for a follow-up book that would teach the same concepts, but in a way that ... remember that there are always exceptions to every rule When we say that “most guys” appear to think a certain way, realize that “most” means exactly that—most, not all Since we have limited space in...

Ngày tải lên: 14/03/2014, 18:20

35 320 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt

Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt

... Stimulation, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA 4MIT, Boston, MA, USA 5Institut Guttmann, Universitat Autonoma de Barcelona, Barcelona, Spain 6Laboratory ... study design was the lack of power to conduct a multi-factorial analysis that includes all the data (i.e., agonist and antagonist muscle data); therefore future studies with a larger sample size ... relating to agonist-antagonist muscle pairs A single suprathreshold pulse of Transcranial Magnetic Stimulation (TMS) over the hand area of M1 results in a balance of inhibitory and excitatory processes...

Ngày tải lên: 19/06/2014, 08:20

8 432 0
báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx

báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx

... sub-Saharan Africa One major advantage of the differential equation modelling approach is that it lends itself to analytical exploration in ways that stochastic simulation methods not, a quality ... estimates for per-act transmission estimates Hollingsworth et al [28] reanalyzed the Rakai data, determining that the data did not allow for a clean estimate of per-act transmission probability ... biological and behavioural scenarios for various sub-Saharan African populations Sawers and Stillwaggon’s argument that the concurrency models of Morris and Kretzschmar only find an effect because...

Ngày tải lên: 20/06/2014, 08:20

7 460 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... oleylamine/oleic acid mixture at 170 °C is shown in Fig 4 (a) The absorption coefficient for SnS nanoparticles a, was calculated from the average absorption index (A) as a ¼ 4pA=k [4] The spectral...

Ngày tải lên: 22/06/2014, 22:20

5 365 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... oleylamine/oleic acid mixture at 170 °C is shown in Fig 4 (a) The absorption coefficient for SnS nanoparticles a, was calculated from the average absorption index (A) as a ¼ 4pA=k [4] The spectral...

Ngày tải lên: 22/06/2014, 22:20

5 276 0
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

... Transform, MC Gray Hill, NewYork, 1951 19 H M Srivastava and Vu Kim Tuan, A new convolution theorem for the Stieltjes transform and its application to a class of singular equations, Arch Math ... 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution ... Fourier, Fourier cosine and sine transforms of functions f and g has a meaning and belongs to L(R) and the factorization property holds Nguyen Xuan Thao and Nguyen Minh Khoa 424 γ F (f ∗ g)(y) =...

Ngày tải lên: 06/08/2014, 05:20

16 336 0
Báo cáo toán học: "A Pairing Strategy for Tic-Tac-Toe on the Integer Lattice with Numerous Directions" pot

Báo cáo toán học: "A Pairing Strategy for Tic-Tac-Toe on the Integer Lattice with Numerous Directions" pot

... a strategy stealing argument [1], it can be shown that in all strong positional games, either Player has a winning strategy or the game is a draw Thus, it is reasonable to consider an alternate ... positional game in which it is possible for Player to have a winning-strategy One such game is the Maker–Breaker game A Maker–Breaker positional game is where the first player, Maker, only tries to ... yet A ∈ H, |A| < ∞, we should describe what constitutes a win for Breaker in such a game If a Maker–Breaker game is played on a semi-infinite hypergraph (V, H), then we say that Breaker has a winning...

Ngày tải lên: 07/08/2014, 15:22

6 480 1
Báo cáo toán học: "Potential-Based Strategies for Tic-Tac-Toe on the Integer Lattice with Numerous Directions" potx

Báo cáo toán học: "Potential-Based Strategies for Tic-Tac-Toe on the Integer Lattice with Numerous Directions" potx

... A ∩ Vsmall (i) is classified as a small set immediately after Maker’s move during turn i and remains a small set for the duration of the game, and we call A an ancestor of S We note that a small ... Maker–Breaker positional game (there are no draws) It is interesting to note that when × tic-tac-toe is played as a Maker–Breaker positional game, Maker has a winning strategy, as Maker does ... people are aware that × tic-tac-toe is a draw game By using a strategy stealing argument (see [1] for a description), it can be shown that in all strong positional games, either Player has a winning...

Ngày tải lên: 08/08/2014, 11:20

15 241 0
Báo cáo khoa học: " Postoperative Chemoradiation for Resected Gastric Cancer - Is the MacDonald Regimen Tolerable? A Retrospective Multi-Institutional Study" pptx

Báo cáo khoa học: " Postoperative Chemoradiation for Resected Gastric Cancer - Is the MacDonald Regimen Tolerable? A Retrospective Multi-Institutional Study" pptx

... this relapse makes regional radiotherapy an attractive possibility for adjuvant therapy Most previous adjuvant trials have failed to demonstrate significant survival advantage in gastric cancer ... seems to be substantially toxic, with a mortality rate which seems higher than reported in that trial Efficacy data appears comparable to the 4/ original report Following postoperative chemoradiation, ... resection of locally advanced gastric adenocarcinoma received postoperative chemoradiation; 61% were male and the median age was 63 years (range, 2386); 78% had T≥3 tumors and 81% had N+ disease; 87%...

Ngày tải lên: 09/08/2014, 09:21

32 509 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx

... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... hyperthermia, kidney failure, seizures and intracranial hemorrhage [9] It is important to note that ecstasy promotes an increased antidiuretic hormone release, which may lead to symptomatic hyponatremia ... mEq/L Anion gap 30.9 21.6 peritoneal irritation Her temperature was 37.3°C and the chest X-ray was normal Urine analysis showed pronounced ketonuria and an absence of pyuria; a urinary bacterioscopy...

Ngày tải lên: 11/08/2014, 03:21

3 400 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx

... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... hyperthermia, kidney failure, seizures and intracranial hemorrhage [9] It is important to note that ecstasy promotes an increased antidiuretic hormone release, which may lead to symptomatic hyponatremia ... mEq/L Anion gap 30.9 21.6 peritoneal irritation Her temperature was 37.3°C and the chest X-ray was normal Urine analysis showed pronounced ketonuria and an absence of pyuria; a urinary bacterioscopy...

Ngày tải lên: 11/08/2014, 07:20

3 327 0
Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

... us to Withaferin A (WFA), a steroidal lactone isolated from the herb Withania somnifera (also known as Indian Ginseng and Ashwagandha), which is widely used in traditional Indian medicine as an ... infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse effects ... Gunaherath GM, Shirahatti N, Mahadevan D, Gunatilaka AA, Whitesell L: Actin microfilament aggregation induced by withaferin A is mediated by annexin II Nat Chem Biol 2006, 2:33-38 Jayaprakasam B,...

Ngày tải lên: 11/08/2014, 08:22

5 306 0
báo cáo khoa học: " The changing trends in tobacco smoking for young Arab women; narghile, an old habit with a liberal attitude" ppt

báo cáo khoa học: " The changing trends in tobacco smoking for young Arab women; narghile, an old habit with a liberal attitude" ppt

... hubble-bubble) and cigarette smoking among pregnant women in Lebanon Addict Behav 2004, 29(9):1821-1831 12 Moh’d Al-Mulla A AHS, Al-Lawati J, Al Nasser S, Ali Abdel Rahman S, Almutawa A ASB, Al-Bedah AM, Al-Rabeah ... 20 Nafae A, Misra SP, Dhar SN, Shah SN: Bronchogenic carcinoma in Kashmir Valley Indian J Chest Dis 1973, 15(4):285-295 21 Gunaid AA, Sumairi AA, Shidrawi RG, al-Hanaki A, al-Haimi M, al-Absi ... Khraisat AS, Abu-Hammad SM, Dudeen AA, Abdallah MN, Alkilani SM, Al-Shami L, AbuHammad OA: Narghile (water pipe) smoking among university students in Jordan: prevalence, pattern and beliefs Harm Reduct...

Ngày tải lên: 11/08/2014, 18:20

4 316 0
w