a wrapper class does not have a no argument constructor

Information Management Resource Kit Module on Management of Electronic DocumentsUNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 6. TEXTUAL DATABASES AND CDS/ISIS BASICSNOTE Please note that this PDF version does not have the interactive features offered th doc

Ngày tải lên : 31/03/2014, 20:20

... Systems), is a textual database management system designed to build and manage textual databases Database management systems - Textual databases and cds/isis basics – page What does CDS/ISIS ... texts; and • managing of textual data in non-Latin scripts or languages with specific uses of accented characters Database management systems - Textual databases and cds/isis basics – page 12 ... databases and cds/isis basics – page Defining fields The fields and subfields may have variable length, and each of them may have any number of occurrences In this example, you have a repeatable...

17
343
0

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

Ngày tải lên : 19/06/2014, 22:20

... beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, 98(15):8850-8855 Dodart JC, Bales ... experimental autoimmune encephalitis (EAE) and nasal vaccination with glatiramer acetate reportedly decrease amyloid plaques in APP transgenic mice [48] Another report by the same group shows that, ... microglia were noted in areas where A clearance is hypothesized to have occurred [24] Thus, microglial activation has been proposed to facilitate removal of A from the brain following vaccination...

13
410
0

Why Copying LIS from a Developed Country Does Not Work for a Developing Country?

Ngày tải lên : 18/10/2013, 14:15

... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory ... that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed countries SUMMARY (Vietnamese) ... Pharaohs to Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16-21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed Country Does...

2
422
0

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Ngày tải lên : 07/03/2014, 16:20

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... 51SufI-BamHI-rv (5¢-ACGCGGATCCAG TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT ... Strikingly, this band appeared more intense upon incubation of the translation mixture with EDTA and was immunoprecipitated with an antiserum against the HA-epitope (data not shown), indicative of crosslinking...

9
393
0

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

Ngày tải lên : 08/03/2014, 23:20

... no consensus in the data available to suggest organic dairy systems management is significantly beneficial It must be noted, however, that Canadian and North American data is particularly scarce ... Manitoba, Canada Sask, Canada Pelletier et al [28] Canada Robertson et al [33] US Pimentel et al [32] US Type of study Comparative field trial Comparative field trial LCA (of conversion) Comparative ... hectares of land worldwide according to the FAO, and much farmland globally is assigned to non-food crops, suggesting that land availability is not as great a constraint as offered by organic...

41
524
1

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... samples, no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The ﬁnding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...

14
416
0

Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

Ngày tải lên : 18/06/2014, 19:20

... and was critical to study design and completion All authors have read and approved the final manuscript Author disclosure statement Nanhai G Chen, Qian Zhang, Yong A Yu, and Aladar A Szalay are ... testing as a novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest due to several advantages ... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1,2†, Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2,...

14
490
0

Báo cáo hóa học: "Short-term locomotor adaptation to a robotic ankle exoskeleton does not alter soleus Hoffmann reflex amplitude" doc

Ngày tải lên : 19/06/2014, 08:20

... induce an alteration of reflex responses during human walking, it would have considerable potential as an aid for gait rehabilitation in addition to reducing manual assistance from the therapists ... exoskeleton assistance during walking may occur in two phases, a quick adaptation that occurs in the first few hours or days and a much longer adaptation that continues for weeks [60-62] The two adaptation ... [10-13] Page of 8 10 11 12 13 14 Acknowledgements The authors thank Evelyn Anaka, Danielle Sandella, Catherine Kinnaird and members of the Human Neuromechanics Laboratory for assistance in collecting...

8
348
0

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

Ngày tải lên : 20/06/2014, 03:20

... and was critical to study design and completion All authors have read and approved the final manuscript Author disclosure statement Nanhai G Chen, Qian Zhang, Yong A Yu, and Aladar A Szalay are ... testing as a novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest due to several advantages ... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1,2†, Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2,...

14
393
0

báo cáo hóa học:" Sexual behaviour does not reflect HIV-1 prevalence differences: a comparison study of Zimbabwe and Tanzania" ppt

Ngày tải lên : 20/06/2014, 08:20

... Demographic and Health Survey 2005-06 Calverton, Maryland: Central Statistical Office and Macro International Inc; 2007 Page of 21 National Bureau of Statistics [Tanzania] and ORC Macro: Tanzania ... and Health Survey 1999 Calverton, Maryland: Central Statistical Office and Macro International Inc; 2000 19 National Bureau of Statistics [Tanzania] and Macro International Inc: Tanzania Reproductive ... paediatric AIDS in Rwanda AIDS 1992, 6:1515-1520 38 Prazuck T, Tall F, Nacro B, Rochereau A, Traore A, Sanou T, Malkin JE, ApaireMarchais V, Masson D, Dublanchet A: HIV infection and severe malnutrition:...

9
449
0

Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx

Ngày tải lên : 07/08/2014, 18:20

... PHGPx and GAPDH were 462 and 302 bp, respectively The relative absorbance of specific mRNA was normalized to the relative absorbance of GAPDH mRNA Statistical analysis Data were analyzed using SAS ... 10% and artificial illumination of a 12-hr light-dark cycle All animals received humane care as outline with “Guide for the care and use of animals” (Chungbuk National University Animal Care ... did not cause any change in the testis, epididymis, and prostate (Fig 6A, 7A, & 8A) The 17βestradiol treatment also caused the hyperplasia of epithelial cells and proliferation of interstitial...

8
343
0

Báo cáo khoa học: "A pre-operative elevated neutrophil: lymphocyte ratio does not predict survival from oesophageal cancer resection" pps

Ngày tải lên : 09/08/2014, 03:21

... local database for oesophageal cancer Demographic details, pre-operative staging data, operation type, histopathological diagnosis, staging and survival were extracted from the database Pathological ... Prognosis would be assessed against standard clinical and histopathological data Page of 10 Table Demographics and preoperative haematology results from patients with resected oesophageal cancer ... vascular and cardiovascular diseases [17,18] All patients undergoing oesophagectomy have preoperative full blood counts taken routinely The NLR can be calculated easily from the data already available...

10
224
0

Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

Ngày tải lên : 09/08/2014, 10:23

... Biotechnology Inc Huntsville, AL USA) The primer sequences used were: for β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and ... immunohistochemical stainings and the immunohistochemical analysis JL performed the RT-PCR and mRNA analysis ES, CG, UA and HEH prepared the manuscript All authors read and approved the final manuscript ... Statistical analysis Wilcoxon's signed-rank test was used for the analysis of matched pairs for protein data as well as for the analysis of mRNA data for the whole group Spearman rank sum test was...

8
529
0

Báo cáo y học: "issed opportunities for participation in prevention of mother to child transmission programmes: Simplicity of nevirapine does not necessarily lead to optimal uptake, a qualitative stud?" pdf

Ngày tải lên : 10/08/2014, 05:20

... Providing a regimen that starts early in pregnancy should also be feasible as South Africa has an antenatal attendance rate of 90% and a mean number of ANC visits greater than three[10] Page of (page ... (Weliswa Binza, Vuyo Magasana, Pumza Mbenenge, Thantaswa Mbenenge, Thoko Ndaba, Nokuthula Radebe), the staff at the ARV clinics and all the respondents References Bradshaw D, Bourne D, Nannan N: What ... nurse gave her the tablet to take it immediately on the same day although she was not feeling labour pains On the (next day) at about am she felt labour pains and she was given another tablet...

5
426
0

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Ngày tải lên : 11/08/2014, 03:20

... 13.5 60.0 Data Analysis Data were presented as mean ± SD of mean The effect of genotype (WT and TLR4 mutant) within the diet (LF and TF) was assessed with a 2-way analysis of variance (genotype × ... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi...

7
272
0

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Ngày tải lên : 11/08/2014, 06:22

... 13.5 60.0 Data Analysis Data were presented as mean ± SD of mean The effect of genotype (WT and TLR4 mutant) within the diet (LF and TF) was assessed with a 2-way analysis of variance (genotype × ... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi...

7
238
0

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Ngày tải lên : 11/08/2014, 08:21

... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... monocytogenes-based immunotherapies Expert Rev Vaccines 2008, 7:1069-1084 Bakardjiev AI, Theriot JA, Portnoy DA: Listeria monocytogenes traffics from maternal organs to the placenta and back PLoS Pathog ... immunizations Hematological values and liver chemistries were unremarkable at all time points These results demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was...

7
393
0

Báo cáo y học: " Ingestion of 10 grams of whey protein prior to a single bout of resistance exercise does not augment " doc

Ngày tải lên : 11/08/2014, 23:21

... key regulator Maximal activation of Akt occurs through phosphorylation of Ser473 and it appears that Akt may have a relatively short period of activation after an acute bout of resistance exercise ... 5.25 g EAA) was apparently insufficient to reach an amino acid dosage capable of stimulating Akt/mTOR pathway activity A number of limitations exist in the current study Firstly, we only assessed ... participants had their body mass measured according to standard procedures using a self-calibrating digital scale (HealthO-Meter, Bridgeview, IL, USA) with an accuracy of ± 0.02 kg Participants...

9
193
0

Báo cáo khoa học: "nti-L-selectin antibody therapy does not worsen the postseptic course in a baboon model" pps

Ngày tải lên : 12/08/2014, 23:20

... to measure alanine aminotransferase, creatinine, and total protein (Roche, Basel, Switzerland) or lactate (Boehringer Mannheim, Mannheim, Germany) A Cobas Fara centrifugal analyzer (Roche, Basel, ... enzyme-linked immunosorbent assay (ELISA) method IL-6 was determined using an immunoassay on microplates In this assay, a mouse monoclonal antihuman IL-6 antibody (5E1) was used for coating and a rabbit ... and arterial pCO2, are summarized in Table The only significant cardiovascular difference was found in mean arterial pressure at 32 h, but was not reflected in cardiac output and SVR Cardiovascular...

10
361
0

Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx

Ngày tải lên : 12/08/2014, 23:23

... Variables were expressed as mean ± standard deviation A two-way analysis of variance (ANOVA) for repeated measures was conducted to study the effects of time and PV measurement on recorded parameters ... not significantly and durably affect oxygenation and haemodynamic parameters in ARDS patients 13 14 Matamis D, Lemaire F, Harf A, Brun-Buisson C, Ansquer JC, Atlan G: Total respiratory pressure-volume ... measurement was corre- lated with the maximal increase in Pao2 after PV measurement using both methods (data not shown) The maximal increase in Pao2 after PV measurement using both methods was not different...

5
314
0