a viewpoint of microscopic quantum scatterings by electric and magnetic dipoles
Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf
... OCEAN AVENUE 718-676-0126 Paratransit B90605 ALMAZ TRANSPORTATION INC 2313 AVENUE X 718-769-5600 Paratransit B90537 ALTA MEDICAL TRANSPORTATION, INC 2834 CONEY ISLAND AVENUE 212-202-5555 Paratransit ... FIRST CLASS C/L SVC CORP 4980 BROADWAY NEW YORK, NY Last updated Thursday, February 07, 2013 Page of 70 Manhattan Name of Base Street Address Telephone Base Type License # SEAMAN RADIO DISPATCHERS ... GUY'S CAR SVCE 1845 ROCKAWAY PARKWAY DREAMLAND CAR & LIMO.SVC INC 9732 SEAVIEW AVENUE GEORGE TOWN MANAGEMENT INC 919 EAST 107 STREET TRANSIT PVT C/S INC 1417 ROCKAWAY PARKWAY JAH LOVE 582 EAST 88...
- 70
- 615
- 0
Tài liệu BONDS OF BLOOD AND HONOUR: A DUAL-STATTED INTRODUCTORY ADVENTURE FOR A GAME OF THRONES RPG WRITTEN BY JASON DURALL pptx
... Heidemann, Matthew Hoffman, Andrea Keller, Sebastien Malangeau, Hans Manhave, Scott Martin, Darren Miguez, Shawn Moore, Eden Rabatsch, Jeff Rasar, Susan Ray, Darren Richley, K.C Saniga, Pierre-Alexandre ... Charge; Weapon Focus (Greatsword); Weapon Specialisation (Lance) Weapon and Armour Proficiencies Simple and martial weapons; light, medium, and heavy armours, and shields Special Abilities Armour ... appropriate player characters aside and asks about what Lord Locke said to them She implies that she is afraid for her husband’s faculties, and that he might have been swayed to this action by...
- 24
- 446
- 1
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
... ratio change in favor of n-3 PUFA and particularly an n-3 DPA and EPA An increase in n-3 DPA and EPA, and perhaps other n-3 PUFAs, stimulates Jak2 and Stat5 activation, and induces b-casein expression ... differentiation effect of pregnancy Table Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands Whole inguinal mammary fat pads were isolated and contents ... development and differentiation The effect of an n-6 ⁄ n-3 ratio change on mammary gland development and differentiation was assayed by morphological analyses of ductal elongation and appearance of a differentiated...
- 12
- 421
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen, ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G...
- 8
- 345
- 0
A History of AeronauticsThe Great Events by Famous Historians, v. 13 pptx
... right of traffic with the islands of Madagascar, Bourbon, and France, the coast of Sofola in Africa, the Red Sea, Persia, Mongolia, Siam, China, and Japan The commerce of Senegal, an acquisition of ... intolerance; Virginia, by ambitious cavaliers; Carolina by the scheming and visionary Shaftesbury, and others, for private aims and individual aggrandizement; but Georgia was planted by the hand of ... the Afghan Governor of Khorasan, by whom he was at first raised to rank and command, as a reward for his valor in actions with the Usbegs, and afterward degraded and punished with the bastinado...
- 208
- 411
- 0
a dictionary of chinese characters accessed by phonetics
... that similar looking characters can cause by printing them alongside each other All characters are given in both their traditional and simplified forms Appendix A clarifies the choice of characters ... Library Library of Congress Cataloging in Publication Data Paton, Stewart A dictionary of Chinese characters : accessed by phonetics / Stewart Paton p cm Includes bibliographical references and ... Department of Languages of Heriot-Watt University, Edinburgh: Professor Ian Mason and Dr Jerry Payne Even though I did not always accept the comments and criticism offered, I was always glad of...
- 270
- 440
- 0
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf
... inhibition of VCAM-1 expression in cerebral vasculature by anandamide provides a new mechanism that may explain the therapeutic action of increased anandamide tone in neuroinflammatory diseases like ... A, Bari M, Granata F, Gasperi V, De Stefano ME, FinazziAgrò A, Strom R: Regulation by cannabinoid receptors of anandamide transport across the blood-brain barrier and through other endothelial ... clinical form of the disease [8] The endocannabinoid system (ECS), consists of endogenous ligands (AEA and 2-AG) and congeners, target receptors, synthesis (NAPE-PLD; DAG lipase), and degradation...
- 13
- 466
- 0
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf
... linkers for the HinP1I-site (GACGATGAGTCCTGAT and Phosphate-CGATCAGGACTCAT, 1:1) and the CviII-site (CTCGTAGACTGCGTACG and Phosphate-ATCGTACGCAGTC, 1:1) were ligated to the complete phenol-purified ... ligase (Roche, Mannheim, Germany) The first amplification stage (20 cycles, 50 μl reaction volumes) used 300 nM of primers CTCGTAGACTGCGTACGATG and GACGATGAGTACTGATCGC at 56°C annealing temperature ... Zylberberg M, Avila PC, Boushey HA, Ganem D, DeRisi JL: Microarray-based detection and genotyping of viral pathogens Proc Natl Acad Sci U S A 2002, 99:15687-15692 Allander T, Andreasson K, Gupta S, Bjerkner...
- 10
- 432
- 0
báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt
... EXTRA funds and supported by the Norwegian National Council of Mental Health Thanks to all parents and patients participating in the study, and to all personal at the Department of Child and Adolescent ... parametric test Correlations were calculated by Pearson r and Spearman’s rho An alpha level of p < 0.05 indicated statistical significance Results Preliminary analysis The Spearman’s correlations ... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined...
- 9
- 494
- 0
The Project Gutenberg E Book of Lombard Street: A Description of the Money Market, by Walter Bagehot doc
... borrowed capital As has been explained, a new man, with a small capital of his own and a large borrowed capital, can undersell a rich man who depends on his own capital only The rich man wants the ... task when we have a difficult task, or that we are living in a natural state when we are really living in an artificial one Money will not manage itself, and Lombard street has a great deal of ... from the risk of failure By the law of England the legal tenders are gold and silver coin (the last for small amounts only), and Bank of England notes But the number of our attainable bank notes...
- 672
- 336
- 0
A self organizing neural network model for a mechanism of pattern recognition unaffected by shift in position
... matches with that of the standard pattern situated at a certain location, and that, at the same time, the lower part of this input pattern matches with that of the same standard pattern situated ... the largest output is chosen as a candidate for the representatives Hence, there is a possibility that a number of candidates appear in a single S-plane If two or more candidates appear in a single ... Fig Relation between S-planes and S-columnswithin an S-layer case only one candidate appears in an S-plane, the candidate is unconditionally determined as the representative from that S-plane If...
- 10
- 575
- 0
A Dialect Of Our Own Design by Simon Colison
... Understanding Outcome AFFORDANCE An affordance is a quality of an object, or an environment, that allows an individual to perform an action AFFORDANCE SEMIOTICS The study of signs offering an explanation ... hierarchies, create bonds between elements, add pace or emotion COLOUR THINK SMARTER PART TWO AND SO TO WEB OUR VISUAL GRAMMAR OUR MISTAKES UNIQUE PATTERNS AND INTERACTIONS EVOLUTION OF THE FRAME ... explanation of how people extract meaning from words, sounds and images SEMIOTICS Symbol Icon Index TYPOGRAPHY By using typography we give a written idea a visual form TYPOGRAPHY COLOUR Colour can...
- 70
- 255
- 0
Báo cáo y học: " Systems-level comparison of host responses induced by pandemic and seasonal influenza A H1N1 viruses in primary human type I-like alveolar epithelial cells in vitro" pdf
... for further GO and pathway analysis GO and pathway over-representation analysis as well as further analysis of protein-protein interactions and transcription factor regulation were carried out using ... 3000 7G (Affymetrix) GeneSpring GX 11 (Agilent) was used for the normalization, filtering and statistical data analysis of the Affymetrix microarray data The linear data was first summarized using ... complex and activate the JAK-STAT signalling pathway, which then results in downstream induction of genes such as ISGF3, a trimetric transcription factor complex of signal transducer and activator of...
- 9
- 359
- 0
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf
... 1.55 × 10-6 -10 GCGCGCGC RTAAAYAA* 18 391 11 6.52 × 10 14 7.70 × 10-12 1.65 × 10-9 1.68 × 10-12 WWWTTTGCTCR* 15 17 4.15 × 10-1 4.09 × 10-1 AAAAAAAAAAAAAAAAAAAAAAAA TAWWWWTAGM* YCCNYTNRRCCGN* GCGCNNNNNNGCGC ... “homogeneous”) of a selection of known TFs (marked with a star) as well as arbitrary candidate patterns Several known TFs appear to be highly significant (e.g., TF AAGAAAAA with a P-value of 1.31 × ... value: e g., Pattern ODZR has an exact P-value of 5.78 × 10-5 and an approximate one of 2.81 × 10-4; Pattern BZOU has an exact P-value of 2.56 × 10-11 and an approximate one of 4.49 × 10-5 As...
- 18
- 409
- 0
Bees and their role in forest livelihoods A guide to the services provided by bees and the sustainable harvesting, processing and marketing of their products
... Another name used for Apis cerana is the Asian hive bee, and it is sometimes incorrectly named Apis indica Apis cerana is indigenous to Asia between Afghanistan and Japan, and occur from Russia and ... in West Kalimantan), Malaysia, and the Andaman Islands, India BEEKEEPING For thousands of years it has been known that obtaining a honey crop is made much easier and more convenient than honey ... East Asia, ‘bee trees’ in Malaysia, and many other examples) Apis laboriosa (cliffs in Bhutan) Apis mellifera (Africa) And many other examples… Many species Cavity nesting species: Apis cerana...
- 204
- 383
- 0
Native and Non-Native approaches to teaching English as a Global Lingua Franca as perceived by teachers and students at the Faculty of English Language Teacher Education, ULIS – VNU
... Bilingualism Clevedon: Multiingual Matters, 96-116 Canagarajah, A S (2006) Negotiating the local in English as a lingua franca Annual Review of Applied Linguistics 26, 1970218 Canagarajah, A S (2005) ... Linguistics, Madison, WI Canagarajah, A S (2007) Lingua franca English, multiplingual communities, and language acquisition The Modern Language Journal, 91, 923-939 Canagarajah, S., & Said, S B (2009) ... communication, and (some) fundamental concepts in SLA research Modern Language Journal, 81, 285-300 Fukumura, A (1993) Qualifications of Language Teachers and English as an International Language TESL...
- 12
- 816
- 7
A Study of Channel Estimation for OFDM Systems and System Capacity for MIMO-OFDM Systems
... 802.11 WLAN protocols Table 1.1 Existing 802.11 WLAN Standards IEEE Protocol Name Standard Approved Available Bandwidth Frequency Band of Operation Non-Overlapping Channels (US) Data Rate per Channel ... mean value of OFDM system capacity for Rayleigh fading channel and Ricean fading channel, by numerical method 165 Fig 6.9: The variance of OFDM system capacity for Rayleigh fading channel ... and the Okumura model and so on Most of them are obtained by a combination of the analytical and empirical methods We next briefly introduce the free space path loss model as an example of path...
- 205
- 638
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25